LOGO title
 Search Sinbase2.0

WWW SITE
 Resources>>Genetics Linkage Analysis>>SLAF Linkage Groups:
 
Note: Please click gene lists to get upstream and downstream flanking genes of corresponding sesame SLAF markers.
Marker ID Location Start End Strand Forward primer Reverse primer Flanking genes Authors
Marker10093 chr1 4,214,829 4,215,167 - GAAGTAGAGAAAGAGGAATGCACAGGGAGA TAGATAATGAAAGTTCAGCTGATATCATAT Gene lists Zhang et al., 2013
Marker11370 chr1 3,812,898 3,813,270 + ATGCCTTAGACAACCAAGTTGGGTAACGCT GCAAAATAATACAGACAAGACATTTTTTGT Gene lists Zhang et al., 2013
Marker11737 chr1 14,668,957 14,669,301 - GACAGATCTCAGTGAATAGAATATATGTGG ATTATTTCGACCCTTTTTCAATTTTTATTT Gene lists Zhang et al., 2013
Marker11950 chr1 4,208,704 4,209,086 + TCTCTTGAACAAGTATTCGATTGGTGACCT ATGGTCGCAAAGGGTTCTGCAGGTTGATGT Gene lists Zhang et al., 2013
Marker11975 chr1 12,230,340 12,230,704 - GCCACACTACTAATGAAGGAATGCAATCCA AACTAGTAGCATGTAAACGGGTGTTCACAG Gene lists Zhang et al., 2013
Marker12054 chr1 3,862,855 3,863,186 - AAAGCTTCATGGGGCGATTCAACAACGAAA TACCAACCCAAGTACCAAAGGTACACTCCA Gene lists Zhang et al., 2013
Marker13351 chr1 3,865,461 3,865,805 - GACAATGGAATTACGAATTTACACCAAAAC AGGAAACAAGCATTCCACTACCATCACGTG Gene lists Zhang et al., 2013
Marker13431 chr1 737,265 737,582 - AAGAGTATCATAGACATGCCATTGGCCTGA TGCCACGTCCTCTCCTGTTTGTTTTTATTG Gene lists Zhang et al., 2013
Marker13599 chr1 12,423,043 12,423,404 + TCTTTTACAGACATGAGTAACTAATAGGTG CAAAAACTCCCATCTTGTCAACCCATCACA Gene lists Zhang et al., 2013
Marker14011 chr1 3,796,832 3,797,185 - CAAAGGATGACCACAGAGCCCTTAGACCGT AGGATATCAATAATTCATAAAAATTGAGTA Gene lists Zhang et al., 2013
Marker14319 chr1 1,565,638 1,565,961 - AAAGAAAAAAAAACTTATATTTGTTTGCAG TGCCTTTCCTTTTCTGGCCGCTGAGCGTGA Gene lists Zhang et al., 2013
Marker14722 chr1 4,392,255 4,392,636 + GCCATCAACTTGCCCCGTTTAGGCCGATCA TTTGAATGAGATTGATGATCACTGCTGGTT Gene lists Zhang et al., 2013
Marker14739 chr1 11,897,777 11,898,079 + CAAGCTGGGTAGGTGCATCATAATCAGGGA ACAACATTAGTAATCAAGAAAGTAACTCAC Gene lists Zhang et al., 2013
Marker15465 chr1 12,382,020 12,382,378 - CTCTTGATATTCCTGCTAACTACACACATA CATATAATTATATAAATGAATCATGTAGCC Gene lists Zhang et al., 2013
Marker16126 chr1 10,750,007 10,750,314 - TGGTGTACCCAGAGGGGGGAGGTGATCACG AGTGTCAAGTGAAAAGATTTTGAAGAACTT Gene lists Zhang et al., 2013
Marker16199 chr1 853,790 854,120 + TGTCCAACCAACTTGATATTGTTGTAGAAC AAGCTCAAAAGATATGCACAGCATACATGA Gene lists Zhang et al., 2013
Marker1635 chr1 12,131,466 12,131,817 + ACGTGGTTCCTGATGCCAATGTGTGCTATT TAGTCCATGGAAAAATGTGTTTCCATCAAC Gene lists Zhang et al., 2013
Marker16358 chr1 4,389,297 4,389,645 + TGCATTCAATCTGGCGCTATTCGCTAAACA CAGCGTCTAGGGAATGTGATGTGGAAACTA Gene lists Zhang et al., 2013
Marker1638 chr1 12,245,281 12,245,621 - ATACGTGTAGACATAACCTTTCTGATAATC ATGTGCTTTATGTCCATAGTTGTTCTCCTA Gene lists Zhang et al., 2013
Marker16821 chr1 16,036,876 16,037,220 - CCGAGTTGACCCGGTCAACTCAATCAACGG TTGATCGCTGGAACGGGCATCAAAAATAAA Gene lists Zhang et al., 2013
Marker17960 chr1 10,749,325 10,749,669 + CAGATGAAATTCATGTTCAGTCGGATACTC AAACTCTCCTCTGTGAGATGTATTTCTAAA Gene lists Zhang et al., 2013
Marker18102 chr1 4,391,485 4,391,793 + ACATGTTGCTGGAAAACATCATGTTTGATA TGGGCCTCCCCAAGAAGGCCTGATCATTAG Gene lists Zhang et al., 2013
Marker18349 chr1 12,497,162 12,497,553 + GAGACGAGGGTTTGCATGTCAGTGGAAGCT TTGCCACTTAGAATATAGGACACCATTCTT Gene lists Zhang et al., 2013
Marker19004 chr1 12,334,275 12,334,590 - CATAATTATGGTTCTTACTTCTAACAACTG AGTTGATATCTTGTGAAATCTCTCATCTCA Gene lists Zhang et al., 2013
Marker20748 chr1 12,386,831 12,387,175 + ACTAGAAAAAATATAAAGCAATACTATGTT CTTTTCGGGAATGAGCGAGTCAGATATCAA Gene lists Zhang et al., 2013
Marker20858 chr1 14,781,788 14,782,098 + ATAATTTCTTGCAAGCAAACACACAAGTGA GTATAGCACTAATTTATAACTTTTCACGGA Gene lists Zhang et al., 2013
Marker21273 chr1 12,346,488 12,346,833 + GCCGCCAAAACCAGCATAAGCGATGGACAC GGTGTGGATACCCTAAAATCAGTGGACAGA Gene lists Zhang et al., 2013
Marker21537 chr1 4,404,606 4,404,992 + TAGGTCGATTGAATAAGTGCCGAATTGACT GAGCAATTTGGTATCACGGGATCTCAAGTA Gene lists Zhang et al., 2013
Marker21763 chr1 14,601,699 14,602,041 + GTATAGTTTTGGCAAAACATAGTCATTGGG TGTTTCCATGGGTTTTGATTCTTTTAGCTT Gene lists Zhang et al., 2013
Marker21945 chr1 14,740,621 14,741,007 + CTGGAAAAATCGAGAGTTGGAGCGAAGAAA GCTGAGTTCACACCTGTGAGGTCAATTTAT Gene lists Zhang et al., 2013
Marker22037 chr1 3,736,586 3,736,958 + AGCTCGACAAAACATTCAACCCAAAAGGCC GGATACCTCTCTTACTCTCTAAATTATCCC Gene lists Zhang et al., 2013
Marker22049 chr1 14,119,876 14,120,255 - ATGCTAGCATCTTCGACAATCTCACTTGCT CACGAAGCCAAACAACATATAACAGACACC Gene lists Zhang et al., 2013
Marker2215 chr1 13,486,974 13,487,331 - GTCTCTGACATTTTTCATTTATTTGGACTT CAAGTTGTGGCATTACTCTCTGATTCCTCT Gene lists Zhang et al., 2013
Marker22226 chr1 4,001,123 4,001,421 - CCTGTCGGCTAATTGCAATGAAGATAATTT GATAGCATTTCGACCAAATTTTCATGCCAT Gene lists Zhang et al., 2013
Marker22266 chr1 15,359,163 15,359,512 + AGAAGTTGTCATCTCGCTGGAGCTGTATTG ATCTGGTGATTGTTCCTCGACATTCGGTCA Gene lists Zhang et al., 2013
Marker22613 chr1 777,496 777,790 - ATGATATAATGTTGTAATTTATCCGGACAC TATATTGCATAATCGAACGATGTGCAAGCA Gene lists Zhang et al., 2013
Marker22649 chr1 18,682,813 18,683,116 + CCCTTCGACACGCAAGTTAGTAAGGTCGAA CTTATAAATAGATATTTTTGGTACTTCACA Gene lists Zhang et al., 2013
Marker2265 chr1 10,751,504 10,751,860 + CCCCTTTGCAGAAATGCACACAATTCTTCA AATCCATGTTTATAATCAGCAAAATTGATC Gene lists Zhang et al., 2013
Marker22688 chr1 12,413,655 12,413,998 - CATGCTATGGTAATGATCTTGAACTTCATT CACACCAAGTCGTCTCTATGTTTTACTTAT Gene lists Zhang et al., 2013
Marker22704 chr1 12,073,620 12,074,001 - TCTCTCTTAGGTTAGCGGGCACAAGTGAAT CCAAGTGAGATGCTATGTTTTTAGCTAATT Gene lists Zhang et al., 2013
Marker22894 chr1 904,139 904,503 - TACTGCAAATACATCCCTAAAACACCATGA TGTCATCTGCAAGTGTCAAATCCGGCATCG Gene lists Zhang et al., 2013
Marker22945 chr1 12,421,116 12,421,468 - AAATGCGAGGTTTTGGGAGGTATCTCAAAG GTATCTTTTGGTTTTACTTTTGTTATTTGT Gene lists Zhang et al., 2013
Marker23000 chr1 14,243,548 14,243,857 - TTTATCCTCTCCTTCAGTAGCAATTAGAAA TTCAATTCCAACACTGGAAATCCCTTCGTG Gene lists Zhang et al., 2013
Marker23257 chr1 17,228,749 17,229,137 - GTCATACATTTGACAAAACAGATTACTTAC CTACTGTCATGTCACTGCAAGCTTTTCCCT Gene lists Zhang et al., 2013
Marker24165 chr1 10,829,251 10,829,573 - GTTGGAACAAACCAGACAAGTGGAGATATA TATCAAATAAGGGTCATGGGTCATATTATT Gene lists Zhang et al., 2013
Marker24640 chr1 905,503 905,862 - AAGCGAGATTGGCTTTCCTGATTTTAGGGT TAGCTATCGTTAGTTCAGGGTATCGACATT Gene lists Zhang et al., 2013
Marker2478 chr1 4,410,599 4,410,945 - CTATTGTTGATGATTTGAGTTGATGTACTT CAGATGCAATTCTAACTGCAACACACATCA Gene lists Zhang et al., 2013
Marker25603 chr1 3,945,091 3,945,421 + AAAAATAGAAAGATACAGTAAGGGCAAAGT ATTGTGCTTACTAGTTACGTGGAACGGTGT Gene lists Zhang et al., 2013
Marker25612 chr1 14,546,429 14,546,774 - TTTCCCTACCCTCTTCATCTTTCTAATTTC TCAGAATTTGCCTAAGGAAATTGAAGCTTT Gene lists Zhang et al., 2013
Marker26090 chr1 1,796,627 1,797,010 + ATGAGCAGGCTTATATTAGAACCCTCGCAT TCTCATGCGATAATTTTCGGATGTTCGAGT Gene lists Zhang et al., 2013
Marker26092 chr1 12,061,092 12,061,392 - CAAAGATATAATGATGCCACAAAAACTGTG AAATTCGGGTCACAAAAAATACTGCCTCAA Gene lists Zhang et al., 2013
Marker26761 chr1 825,681 826,044 + AGAGACATAGTTTCCGTCTCTTTTCGGTAA ATAATGGACTGTCAATCAAGACTTCAGAAC Gene lists Zhang et al., 2013
Marker2677 chr1 12,309,800 12,310,161 + GAGTGATGTATACAGCTTTGGGGTTGTAAT AATTCCATAATTTCATTTCGTTGCAGTTTG Gene lists Zhang et al., 2013
Marker2681 chr1 4,419,765 4,420,107 + TTTTCGAGTTACTGAGAACATAGGCGCTCT GGCAACAGAGCAGCATTTTGGATACACGTG Gene lists Zhang et al., 2013
Marker27469 chr1 6,131,177 6,131,553 + ACCCTAGAATAGGGCGGCGCACCTTGTCTC ATGTTTTTCGCCGGAAACCAGTCGTCGGTC Gene lists Zhang et al., 2013
Marker2761 chr1 8,459,110 8,459,475 + CCAACACCATGAAGTAGAGAAGCAAAATAA ACAATTTCATGATAGCTCATATACACCGCA Gene lists Zhang et al., 2013
Marker28527 chr1 3,718,423 3,718,775 - AAAATTACAATCAAGTACACAATGTAATGT AATAATAATCCTTCACCATTTGATGCAGCA Gene lists Zhang et al., 2013
Marker28743 chr1 4,385,806 4,386,104 - GGACAATTATTGAGTGAAGGTGAATGTAAA TTACAACCAAATGAAGAAGAAGAATTTTGT Gene lists Zhang et al., 2013
Marker29071 chr1 3,760,842 3,761,234 - AATTGAGTTTGCACCATGGTGAGGAAATTG ACATGAAATACAGAGCAGGATATGTTTTTC Gene lists Zhang et al., 2013
Marker30238 chr1 14,582,174 14,582,492 - TACGGTACACAAGGGATCAAGAACGGCGAA TACCAAAGAAACTGAGAACGTTACTGGGAA Gene lists Zhang et al., 2013
Marker31053 chr1 9,563,328 9,563,624 - GAGCAATCTCTACTTTACATGGTAACCCAT CAAGGAAATCTTTCAGATAATCATGAGGGT Gene lists Zhang et al., 2013
Marker31557 chr1 10,766,767 10,767,062 - TACTTTACTCTTCCTATTACCAAACCTTAC AAGTATGTAGCCATGTTTTCTTCAAGGGCT Gene lists Zhang et al., 2013
Marker31573 chr1 4,215,172 4,215,473 + CCTGCTCCTCATCCTTCTCCCTGTCTCATC TTAGGCTGATAAGGTGGTTCTCTTTCTTTA Gene lists Zhang et al., 2013
Marker31764 chr1 3,892,352 3,892,689 - TTTCATATAGTTTTTGGGACGACCAAATAA GTGCATATGCACTTGATTAGGTAGAATTGC Gene lists Zhang et al., 2013
Marker31876 chr1 773,784 774,101 + TTCTCCTTCATGGTTGACAGTTGAAGTAAA ATATATTGATTCCTTCAGGTGCACTTTCTA Gene lists Zhang et al., 2013
Marker32296 chr1 10,703,461 10,703,780 - CAGGTATATTTCCACAATAGATGCCGTGAG GCGAGTGATGATGCCAAGGAAGCTAGTCGT Gene lists Zhang et al., 2013
Marker34543 chr1 14,679,717 14,680,041 - TACTACCAGTATTGGGTGAAATTTCGAACA ATTCACTAAAATTGATATCCTTCTCTTCCT Gene lists Zhang et al., 2013
Marker34919 chr1 12484783 12,485,099 - CGTAAAAGTTCATATACATCGAGTTTTACA ATATGTATATACGAGCGCGTGCGGTAATTA Gene lists Zhang et al., 2013
Marker35750 chr1 9,615,437 9,615,758 - TAATTGCTCCAAACTCTTCAAACTATAAAT AGATCAGGTCAGGGAGCGTAAATGTAAGGA Gene lists Zhang et al., 2013
Marker35993 chr1 8,406,404 8,406,737 + TGTACTTGGGATCAATTTATTTGTGTGTTC AAAATTTTCAATTTCTACCATTCGAAATTC Gene lists Zhang et al., 2013
Marker36032 chr1 4,021,006 4,021,295 - AGTAGATAAAGAGTCTGAACAGCGGAGGTT AGGTTTCTATGATCTTGCTCTTCCTGGACA Gene lists Zhang et al., 2013
Marker37018 chr1 4,381,685 4,381,996 + CCAGTTACTTGACAAAGCTGAAGAAATTGT AATGCCAATAATACAACATACGAGGTGGCT Gene lists Zhang et al., 2013
Marker37164 chr1 727,686 728,049 + GTTCCTGACAGGAATCTTATGCTATCATAT TACAGATATCTATACATTCTGGAGTATGGT Gene lists Zhang et al., 2013
Marker37996 chr1 4,420,911 4,421,187 + TTGCATGTCCAAGCATCATACAATGAGTGC GTCCAGTATTCCATTGGAAGGTGCCGAAGT Gene lists Zhang et al., 2013
Marker38200 chr1 13,459,804 13,460,178 + AATATGTTATACAACAAAAAAGCCAAGTAT AACATATTGGTTTTCTTGAATTGATTTCTT Gene lists Zhang et al., 2013
Marker38429 chr1 14,637,642 14,637,986 + AAACAAAATCTAACATCTTGAACTTTGAAA AAAGGGTCAATTTGAGTGAAAGGGACAGCC Gene lists Zhang et al., 2013
Marker38513 chr1 9,492,639 9,492,961 + TTAGTACAGAAACTAATTACATGTGTCACA ACGCTATAACACTTCATTTAGCCAAACACT Gene lists Zhang et al., 2013
Marker39624 chr1 751,849 752,142 - TTAGTCCGTTGGAGCGTTCAAACCCTAAAT TCGTCCTCGCTACTCTGGTCAGTTGGTTTT Gene lists Zhang et al., 2013
Marker40204 chr1 9,501,940 9,502,276 - AATAAATTATATGACAAGTATAATATAATT TGAAGTCCGAGCATTCCCTCTTCTTTCTCC Gene lists Zhang et al., 2013
Marker40309 chr1 807,137 807,419 - CAGCCCAACGGCGAAAAATGCACGTCTTAT GAAAATCAAGATTTACCAATTCTTGATACC Gene lists Zhang et al., 2013
Marker40537 chr1 12,431,102 12,431,486 - CTGGCATTCAAGGATTTGCTTTTCAAGATA GAGCTTCCAGACATGTGATCCTCCCTCAAT Gene lists Zhang et al., 2013
Marker40868 chr1 9,625,663 9,625,984 + CCAGTAAAATTTGCAGTAAACATACTGATG TTTTATTCTGGCAACTCTCCTCACGAATGA Gene lists Zhang et al., 2013
Marker40932 chr1 801,021 801,437 - ACACGACGCGGCCGCAGATGGGTCGTTTCC TACATAGTTTAGTTTTCGAATTGATTCCAA Gene lists Zhang et al., 2013
Marker42202 chr1 3,895,407 3,895,738 + ATTTCAACAGATGTTAGATCATGGCCCTTG CTTGCAAGCACTGTAGGTATCTAGAACCCC Gene lists Zhang et al., 2013
Marker43133 chr1 4,190,856 4,191,148 - CCATGATAATGGAGACTAACAAATTCAAGG TGCTCCGCATGAAAGAAGTTTATGCGGTTC Gene lists Zhang et al., 2013
Marker43226 chr1 14,652,432 14,652,755 - TATATCTGCTAGTGAATTTTCTCAGCAGTT ACTCCTTCGACTAGATGTTTTCATGTTCGG Gene lists Zhang et al., 2013
Marker44100 chr1 10,807,439 10,814,655 - TCAGCCTATATGTTATTATAAAAAAAATAA GTAAGATCGTATACTTTTGAACCACAAAAT Gene lists Zhang et al., 2013
Marker44455 chr1 10,693,290 10,693,612 + TTTGTGTATTATCAAACTTTTATAGAATTT TGATATCATTGTATCTTTAGATTATTTTTT Gene lists Zhang et al., 2013
Marker44642 chr1 12,528,658 12,528,957 + GGCCAACGAGGCTTTGCTTGAACGGTTTGA ACATTTACACCGATTGATATGAAAAAATAT Gene lists Zhang et al., 2013
Marker44965 chr1 14,655,072 14,655,355 + AATCAAATGTCTTACTCAGGGTTACTCAAA TCACCAAAACAATGCAAACCTTTGGTGCTA Gene lists Zhang et al., 2013
Marker45388 chr1 2,124,601 2,124,969 - AGAGCATCAAACATTTGAAATTTGGCAGGC GTATGTTACCTATTGGGGTCACCATCTTCT Gene lists Zhang et al., 2013
Marker45597 chr1 14,610,884 14,611,183 + ATTCACCTATCTGTTTTGATTTCGTGTGTA GTTTTCCAGGTTTGTTGTTGAGCATTTTTC Gene lists Zhang et al., 2013
Marker45740 chr1 9,143,060 9,143,357 - TAAAATACTCGACCTCAAAAAGACAGGCAA ATCTTTTCTTCCATGGGCCTACGTTGGAGG Gene lists Zhang et al., 2013
Marker46287 chr1 4,404,188 4,404,601 - GATCAACATAGATGTCCCACGTCTGTCGCG TAACATAAGTTTCAAAGATCTATTTTTGGA Gene lists Zhang et al., 2013
Marker46577 chr1 4,073,228 4,073,531 - TCAACCATATACAGAAGGATATAATATTTC ACTATTACATTGTACCTTTAGTTGTAATTT Gene lists Zhang et al., 2013
Marker47053 chr1 14,772,058 14,772,354 + GCCAAATTCTCCATAACCCATTTTGCGCCT TGCGGCTCTCATGTCCTCATCACCGGTGCG Gene lists Zhang et al., 2013
Marker47844 chr1 12,053,425 12,053,700 + AGCAATTGTGAAAATGGTGTTCAGAGTATC TCTCAATCTAAATTTATGATCAGGCTCTGA Gene lists Zhang et al., 2013
Marker48430 chr1 3,970,536 3,970,842 + AAATATTTTGTTTGTCTAATTTTTAGAGTA GGTATGATAAAGTTGATGTAGGCCACCGCT Gene lists Zhang et al., 2013
Marker4921 chr1 10,807,580 10,807,911 - CATGTGAATCGAAACATTAGAAGTAGGCCC GAATAATATACGATTTACTTTCTATGTGTA Gene lists Zhang et al., 2013
Marker49386 chr1 840,504 840,789 - ATCTGAACCTCAAATGGTGTGAAGAATGTC GACTTTTCACTGCTGGGAATCTGAACCTTT Gene lists Zhang et al., 2013
Marker49600 chr1 10,866,137 10,866,430 + AAAAAGGCCTTGGTAGGAAGAGAATACCTT CTGGAATCCTAATCTGTATGATGCTACCAT Gene lists Zhang et al., 2013
Marker50070 chr1 9,544,188 9,544,488 - TCGTAATAAGTTTTGAATCAACGCATTATC TGGATAAATTACGATGTGTTTTTTTTATAT Gene lists Zhang et al., 2013
Marker50071 chr1 12,437,405 12,437,690 - GGAGGCAAGAAGGCATAAGCATTTTTCATT TTAGATCTGAAAAACAGGGAAAAGTGAAGG Gene lists Zhang et al., 2013
Marker5114 chr1 12,334,644 12,334,993 + GTAAAATATCATTGTCCCAGTGACATGAAC AGTAATAAAAAAAGCAGGGCAGCGCAGTGT Gene lists Zhang et al., 2013
Marker51486 chr1 10,695,957 10,696,241 - AAAACTTTCGTTTTCGAATACCCTTGATTC CAAACCCGAAGTCACAGTAGCATACTTTAC Gene lists Zhang et al., 2013
Marker52412 chr1 3,818,026 3,818,320 - TTCTTTATGTTGTTGCTCAAGAGCACTCTG TTGCAAGATGGTTCCTCCAACTACAATAAG Gene lists Zhang et al., 2013
Marker53060 chr1 2,019,553 2,019,853 - AGATTATTTGTGGGTATGATAAACCAAAGC CAAAAACGAGAATCCAAATAATCCACAAGC Gene lists Zhang et al., 2013
Marker53132 chr1 4,427,395 4,427,715 + AGTAAGATCCACAAATCTATCTGTAACAAT TGACTATAAATAGCTAATCTGAAGAGTTGC Gene lists Zhang et al., 2013
Marker53212 chr1 12,117,206 12,117,613 + TGACCGTAGCAACTCAAGTTATCTTCTTGG AATCAATTGTAAATAGAGTAGTGCTAACGT Gene lists Zhang et al., 2013
Marker55140 chr1 10,826,153 10,826,455 - AAGCAAATATTATATAGATTGCAAGCATAC GTCCAGATCATCTGATATTCTGACAGTTCT Gene lists Zhang et al., 2013
Marker55870 chr1 10,795,030 10,795,320 + AATGGTGGAACATTACACATGATCCTGATT AAGTTCTCTTGCCATGTTTGTTTTACGAAG Gene lists Zhang et al., 2013
Marker57175 chr1 4,366,917 4,367,212 - TGTGGAGAAGAGTCATCTTATTATCTCCTG CTTCGACATTCATACTACCAAAAGGGATTA Gene lists Zhang et al., 2013
Marker57283 chr1 10,655,381 10,655,783 - GAGTATCCAATGTTTCTCCATGAAATTCAA ATAACTTCATCATTGCTCACAAAAGAGAAA Gene lists Zhang et al., 2013
Marker59782 chr1 12,271,305 12,271,589 - TGAGAAAATCCTCAATTTGATCATAAAGAA AAGTTCGAAGATAAGGCCACCAGTACCAAC Gene lists Zhang et al., 2013
Marker6170 chr1 9,132,886 9,133,254 - GAAAACGTTATAGACCGATGGCATGTCCAC TCCCCTGTTGGTGCTTTGTGATCAATCTCT Gene lists Zhang et al., 2013
Marker6899 chr1 4,228,926 4,229,260 - GTAGAGAAAGAGGAATGCACTGGGAGAGTG TATATAATGACGGTTCAGCTAATATCATAT Gene lists Zhang et al., 2013
Marker7106 chr1 8,902,339 8,902,675 + TCTCCATTTTCTTTGTATCTTGAATATACA CGTGTGGCTACGCTCATCCCTATTCTTTTT Gene lists Zhang et al., 2013
Marker7488 chr1 4,418,766 4,419,118 + AAACCTCTGGAAACCCGAATAACTGCAGTA ATGAGAGCCAAAAGTGTGCTGTTGATTTAC Gene lists Zhang et al., 2013
Marker7568 chr1 4,380,708 4,381,064 + AGTGTTAGGTCAGAAGTTGAGCTATTCTAT GTTAGACGGTTTGGAGGTAACTCTGTTCAT Gene lists Zhang et al., 2013
Marker7629 chr1 10,820,253 10,820,602 + AATGCTGTTGCTATGAGAAAATATGACATT ATGAAAATTGGTAGGTTCGAGATGTCTGTA Gene lists Zhang et al., 2013
Marker835 chr1 3,718,059 3,718,392 + TAGAGTATTGAAATGGGCTCGATACCTACC GACTCAAATTGGTATTCCTTGCAGTCACGC Gene lists Zhang et al., 2013
Marker8420 chr1 10,868,773 10,869,124 + TTTTCTTCTTCTATGAACATGATTTTGATT TCGGGGATAGCGATCAAATTGAGAACAACG Gene lists Zhang et al., 2013
Marker8744 chr1 12,377,630 12,377,934 + TGGTGTTCATGTCTAACTGAAGCAGAGTCT TCCCTATCCTCTGTCGCTGTTTCCTCTAAG Gene lists Zhang et al., 2013
Marker8753 chr1 2,121,780 2,122,147 + TATTGAGTGCTTCATATCCCATGTACTGCG TGAATATACCATTCAAATGAAGGGAGACAG Gene lists Zhang et al., 2013
Marker9306 chr1 14,544,801 14,545,141 + CAATCATATTATTACTTGTTTTCATTTGTT ATACCAAATCCTATGAGTGACGTCGTATTT Gene lists Zhang et al., 2013
Marker10057 chr2 11,232,207 11,232,554 + AGATTCTTAGGATCATACCGTTGAAGTATT GATCAATTTGGAATATACACATGCCTAGTA Gene lists Zhang et al., 2013
Marker11156 chr2 14,539,621 14,539,956 + CGGGCCACTCTTTTACGAATGAATTTGAGC CTCTTTCAAGGTTATTTGCCTTGTGCTTCT Gene lists Zhang et al., 2013
Marker12729 chr2 7,030,462 7,030,847 + CAGAGAAACGTGGAAGATTGGATGTATCTT GATACCCACATTGCCTGAAATGGTGTTGTT Gene lists Zhang et al., 2013
Marker12870 chr2 17,407,335 17,407,648 + CTTTTCTCGAAATAGAGGAAGACAACAAAG CTATTTCGGCCTACAGACGTTGTGTACTCT Gene lists Zhang et al., 2013
Marker12941 chr2 7,024,046 7,024,379 - TTACCCATCAAAGCCTAAAGTTATTACGAC AGTAGCAATCACATACAAAGCATCATGAAT Gene lists Zhang et al., 2013
Marker1340 chr2 7,223,073 7,223,429 - CAACTTTTTGTCACAAGTATGATGAATAAC TGTAGCATAGAAATGAAATGTGCATTTTCC Gene lists Zhang et al., 2013
Marker14685 chr2 14,828,600 14,828,976 - GGGTTCCACGAAATTACAAGGATTTACAGG GCTCTATTCTTGTATAGCTATTCAGAGGGA Gene lists Zhang et al., 2013
Marker15487 chr2 7,148,738 7,149,041 + TAATGAAGTGTTGGAGGTCCAAGACTTACG TACCAACCTCGATATCACAGGTACACTCCC Gene lists Zhang et al., 2013
Marker16666 chr2 6,601,729 6,602,036 - TACACGTTTCAAGACCTGTCACAAAACCAA TAAAATGCTGCCGTCAGTTCTTTCTTTCTG Gene lists Zhang et al., 2013
Marker17513 chr2 11,179,768 11,180,090 - GATATTGGATAATTGAGGCTGAGATGCTCT TTCCTTCTTGCTTCCCTGCAATATGAACGA Gene lists Zhang et al., 2013
Marker17787 chr2 7,139,809 7,140,172 + GACAACAACAACAGCAATTACTTCCTAAGA TGGTAGGGTGAATGCGGTCGCAAACATACT Gene lists Zhang et al., 2013
Marker18119 chr2 10,947,661 10,947,968 - GAATAGTAAAAAACCATTTTTTCCCCTCTT AGAACAAAAATCTGATATTGGAACCAGGAG Gene lists Zhang et al., 2013
Marker18173 chr2 17,436,489 17,436,870 + AGAGAAAACAGAGAAGCATATTTGATTGCG GGACTGCTTGCAGTATGAGTACTAGCAGTC Gene lists Zhang et al., 2013
Marker18911 chr2 4,282,815 4,283,140 - TCATCCATCTACAGACTACGTGGCTAACGT GGATTTTAGTCCAAATCAAGTTCGGTCGAA Gene lists Zhang et al., 2013
Marker19187 chr2 17,366,128 17,366,463 - GGCCTACAGGGGTCCAGAGGTACACCACAC AATCTACCTTCAATGAAGTTGTGCGACAAA Gene lists Zhang et al., 2013
Marker19247 chr2 10,873,833 10,874,169 - AATCCCAAAATACGGCAAAATGCATACCTT GATCACTTCTGTAGGGTGTTTTGACATCTT Gene lists Zhang et al., 2013
Marker19980 chr2 7,109,881 7,110,249 + ACGCAGGTTAGAGCTCTGCTCTCTCAACTC TTAGATTTCGATTTATTTTTCAAGAAAACC Gene lists Zhang et al., 2013
Marker20565 chr2 8,744,080 8,744,419 + TTGCTCAATTTTGAGACATTTTTCGCCGGA TCGGCAATTTTGAGTGACGCTGGTAGATTT Gene lists Zhang et al., 2013
Marker22693 chr2 6,815,910 6,816,253 + GTCTCTGTTTTTGAAATACCTTTTACACCC AACTCCTAAAGCTACGGGACCAAAATTGCT Gene lists Zhang et al., 2013
Marker23596 chr2 7,104,461 7,104,791 + AATTTGGAATGAAAATAGTGACCATGGAGA CAAAAAATTGTTATAGCAATGGGCAACACT Gene lists Zhang et al., 2013
Marker24796 chr2 10,910,917 10,911,297 - GGGGGTAATTGATGTGGGTTGAATACAGCA TTGGCTCGAATGACCATACTTCTGGATTCT Gene lists Zhang et al., 2013
Marker25188 chr2 7,498,385 7,498,730 - CTTCACCCTTGATCAGAGAGGTTACTGGCC ATTACAAGTATTTATATAGGAGAACAAATA Gene lists Zhang et al., 2013
Marker25247 chr2 6,631,311 6,631,631 + AGGATGTTGCGTATTGCAACAAGGGAGGAT GACCTTTTCTCACTACAGAAAATGCAACAT Gene lists Zhang et al., 2013
Marker25358 chr2 10,781,908 10,782,236 - TAGAAAAGATCAAGTTTACACAGTGATATC AACGAGGTTTAGCTCGTGGTTACCATGAAA Gene lists Zhang et al., 2013
Marker25705 chr2 8,744,424 8,744,821 + AAAGAAGGTGGCGGAAAAAGAGGGGTGCGT ATAAGAGGACCAAATCTAAACTCTAACAAG Gene lists Zhang et al., 2013
Marker25771 chr2 7,096,046 7,096,422 - TCCAAATTGTTTCTTCTCCTAACCTAGTGT ATTTATTTCTTCAGTAAAAATTTTACTGAT Gene lists Zhang et al., 2013
Marker26180 chr2 7,100,097 7,100,427 - GAGATCTAGGCTGACTAGAGTTGAGATATG CGTAAGATTTTTCATAGATTGTTAGACTAA Gene lists Zhang et al., 2013
Marker2640 chr2 10,831,919 10,832,285 - CCTTGTTTGCTTCTATGTAATTGGACTACC ATGCATGACTTCTAGTCCCATATAAGGGAA Gene lists Zhang et al., 2013
Marker27136 chr2 6,636,376 6,636,713 + AATGATCTAAATTGGTTTCAAAATTGATGG CGCATATCGGAACCAATCACTTGTTACAAT Gene lists Zhang et al., 2013
Marker28078 chr2 13,923,460 13,923,842 - GCAGAAATAGACGAAGCGTTATGAAATAGT CTTGTATCAATAGCCTGAGAAAAGTGACGT Gene lists Zhang et al., 2013
Marker28327 chr2 7,241,061 7,241,372 + GTTTCTTCAGACTGGAGAAGCGTGAAGGAG TTGCAATGGGGCCAACAGGTAATTTTTTTT Gene lists Zhang et al., 2013
Marker30077 chr2 11,166,684 11,167,012 + GATCAATCTTCGTATCCATTTGAAGAGCCG TTACACAGCACTTCTGTTTGCCTTCTCTTT Gene lists Zhang et al., 2013
Marker30971 chr2 14,852,652 14,853,043 + CTCCCAGAGACATCTCCAGCAAAGCTGAAG TTATTATCTACTCATAATTTGGTGGGTGTT Gene lists Zhang et al., 2013
Marker31055 chr2 11,031,427 11,031,816 + GAGGTACTACCGAGAGACAGAAGAAACGTG TTTCAGCATTCAAGAAATATATGCAACTAA Gene lists Zhang et al., 2013
Marker31475 chr2 7,094,810 7,095,178 + TAGTTTTCATATAACATATTTTAGTTTTAT TACGCATCAATGGTCGAAGATTCTACACTG Gene lists Zhang et al., 2013
Marker31939 chr2 16,070,364 16,070,731 - ATATTAGTATTATGAATCTCGATTTGCTAT TTTGTTTTACAGGTATATGTTTTTGGATTA Gene lists Zhang et al., 2013
Marker33131 chr2 17,549,490 17,549,781 - GCATCGGAGGCCATCGCCGAGGGCTTCTCG TTGTATGATATGTCACATTATCTCCACTGA Gene lists Zhang et al., 2013
Marker33873 chr2 17,406,996 17,407,330 + CAGTCTGACTATCCACCCGCAGCCCAACTT AGCAGCGAACCATCAAAATCTTGAACTGAT Gene lists Zhang et al., 2013
Marker34246 chr2 8,749,404 8,749,688 - CACTGTGTTCCCAAATGAGTTTCAATTATT TCGCACAAAACTACACCTTTGATTTTGAAT Gene lists Zhang et al., 2013
Marker34347 chr2 14,813,064 14,813,377 - TCCACCATTGTCCATATGAAACTTGGAAAA TGGTACAGTGTGTTGAGAGAAAAAAAAAAT Gene lists Zhang et al., 2013
Marker35489 chr2 10,794,623 10,794,948 + ACATACCTCTGTTGGGGTCATTACTCCAGG CAGGACTCATCAGGAACTTAGCTCCACATT Gene lists Zhang et al., 2013
Marker35905 chr2 7,568,810 7,569,207 - TGCCATTGGATTCCACGGGAAATTTTACGC ATCACAGAGTTTATGATCAGTGGTGGGTTT Gene lists Zhang et al., 2013
Marker36098 chr2 7,053,926 7,054,272 + CATTTGTAACAATTTTTATAGCCAAGTCTG CTAATGAAAGATATGTAAAATAAATCATAT Gene lists Zhang et al., 2013
Marker36234 chr2 11,039,962 11,040,354 + TCGATCTCTACAAGTCAGCTAGCTTTCAAG GAAACTTGATCTCATCGAATTTCCAGTATC Gene lists Zhang et al., 2013
Marker39499 chr2 6,815,417 6,815,741 + ATGATGTAAATGGTCGAGAGGATAAAACTG TTCTGAGTGTTTTCCATATCTACTAGTATT Gene lists Zhang et al., 2013
Marker3964 chr2 9,884,657 9,885,020 - CCCCTTGTGATGTAGGATTCGTGCGTATGC CTGTGAAGTGTTACGCGATCTTGAGTTCCT Gene lists Zhang et al., 2013
Marker40893 chr2 14,858,284 14,858,643 + TCATTCAAGAAAGAAAAAATAGCAGTAATC GAGCTAGTAATAGTTCTTAGCAATTAGTAA Gene lists Zhang et al., 2013
Marker42404 chr2 16,113,819 16,114,206 + TGCCACAGTATTGTCTCCACGGAATAGCTG CAAAGATGAGATTGAGCTGATAGACCATGT Gene lists Zhang et al., 2013
Marker43303 chr2 7,110,353 7,110,639 - GGATCTTGCGAAATATAAAAAAGATTTCTG TCTCATAACAATAAATCCAAGTCTGACACA Gene lists Zhang et al., 2013
Marker43519 chr2 6,710,358 6,710,670 + AGTACAAAATTTTTGTCCGAACCTGTTTGG AGAGAGAGAAAGACTATCATACTGATGCAT Gene lists Zhang et al., 2013
Marker43819 chr2 10,784,079 10,784,365 - CTACTTGACGCCCACCTCATCAGAAGTCTG CAAGAAAAGGTAAACAAAAAGAAGAAAAAT Gene lists Zhang et al., 2013
Marker44322 chr2 7,494,272 7,494,600 - TTTATCCCTTATTTTTAGGTAAAAGGCTTG CCCATTCAAAGTGTTGTGAGCAAAAATAAC Gene lists Zhang et al., 2013
Marker44533 chr2 11,182,129 11,182,521 - CTAGAACTTGAGCTTTACTTATTGGAAAAA CTATGTTCTACTTGTTGACACTTTCTGAAC Gene lists Zhang et al., 2013
Marker45677 chr2 10,779,792 10,780,081 - AATAAGTTTATACACTAAACATGACCAATA ATGGCTCCACTTCAAAATTTGAATTTCCTC Gene lists Zhang et al., 2013
Marker45786 chr2 6,614,931 6,615,308 + ACCATATTTCAAGTGGAAGAAAACATCCAT CATCCTACCAAACACAACGAAGATAGATGT Gene lists Zhang et al., 2013
Marker46338 chr2 17,368,462 17,368,779 - AGTGAAATCTGATGAACCGATAAATGGGAA ACATAGTTTGCTGGTCTATAGGCTCAGTTC Gene lists Zhang et al., 2013
Marker47721 chr2 7,209,482 7,209,808 + ACCGACACCGTGTGAGATGCACGCATATTT TTGTGTTCCCCAAAATGTTGACCCACAATT Gene lists Zhang et al., 2013
Marker47875 chr2 17,385,822 17,386,220 - CTAAGTCAACAAACAAGAAAGGTAATGCGT ATCGAACCAATTTGTAAATGAAATGCTTAT Gene lists Zhang et al., 2013
Marker49298 chr2 6,662,315 6,662,706 + GACATTGTACCTATTTCCCGGTCAGGAGTC GGAAAACATCAGAAAAACACAGAAATAAAA Gene lists Zhang et al., 2013
Marker60489 chr2 7,409,175 7,409,455 + CGAGTTACGTTTGGTACATAAAAAATTTGC AAGAAATGTAGCATTTTTGTGTTTGCAGGT Gene lists Zhang et al., 2013
Marker6500 chr2 12,965,817 12,966,169 - TTAGAGGGCTAATTTTGCAATTTTCCTCAT GATATGTTTGGATTTGGGTTTTGGGGTAAT Gene lists Zhang et al., 2013
Marker6914 chr2 10,945,222 10,945,582 + GTTCGGAGTCGTACTTGAAATTTTTGCAGG TCGCTTTCACTCATACCTTTCCTTTTGGGG Gene lists Zhang et al., 2013
Marker9767 chr2 6,867,259 6,867,598 - GGTCACACTTGGTCAGGGGAATATGAAGAT TTGGGCAGAAAACAGAGATTGAAAAAATAG Gene lists Zhang et al., 2013
Marker10817 chr3 9,905,047 9,905,401 + CAGCAGCCATGCAAGTTTGCAGCTCCTTTT GCAATGTCCCCATACTTTGCGAAGATGGCC Gene lists Zhang et al., 2013
Marker11011 chr3 12,264,248 12,264,585 + AGAGGCCGAGTCAATCATGCATTTCCAGTA AGCTTGCCATAACTGGTCCCACTTATGATA Gene lists Zhang et al., 2013
Marker11389 chr3 14,773,853 14,774,190 + AAAAATCTGATCTTGGTGATATGTTTCTGC GGTGCATTTCACTTGTCGTTGCTGGTATTA Gene lists Zhang et al., 2013
Marker11652 chr3 10,013,210 10,013,561 + AGATGAAGTTCCCGACACCAAATGGAATAG GATTTCAAAGGGATAAGTCAGGTGCATCGC Gene lists Zhang et al., 2013
Marker11811 chr3 3,677,345 3,677,695 + ATCAAGGGACTTCTTACTGTCATTGCCTAT ACAAAACATTATGAAATAAGTCAAAAGCAG Gene lists Zhang et al., 2013
Marker12067 chr3 4,741,128 4,741,494 - CTCGTCCCACATATCGATTTCTGGGGGAAA TCTCTCTAGCAGCTCCTTTTTCCAGGGCAT Gene lists Zhang et al., 2013
Marker12682 chr3 5,024,867 5,025,220 - TTAGCAGTTGCTGGTGCATGAATAAATTTG GTCTCTGACCCATAAAATTGAAAAAGAACT Gene lists Zhang et al., 2013
Marker13038 chr3 5,042,250 5,042,581 + GTTTGTGTTTCCTCAAAATATCACTCACTA ATAAAACAAGAGTACTTCCTAGCCAAATTG Gene lists Zhang et al., 2013
Marker13299 chr3 11,565,458 11,565,772 + AGAAAATGTTACAAAAACCGACCTGTCGGA CATAGCAGGCTCTGAAAAGAAGAAACAGGA Gene lists Zhang et al., 2013
Marker13434 chr3 3,773,783 3,774,130 + GGGATTCGAGGGCCTGTTCGAAGCTTTCTT AACCCATACTATTTTTCTTGCTCGATCGGT Gene lists Zhang et al., 2013
Marker13860 chr3 4,694,239 4,694,559 + TGAAGCAAGAAAATAAGAATAATCAGGACT CCTCCTCTGTTTGTTGAACGGTTTGATGGT Gene lists Zhang et al., 2013
Marker13871 chr3 24,776,997 24,777,300 - TGCCTTTGTGGTTTCTATTATGTTTGTTGG AAACCACATTTCCAGCAGCATGTTTCACAC Gene lists Zhang et al., 2013
Marker13887 chr3 24,859,474 24,859,825 - GTCCTAATTCCAGCTCCATTCCTTCTAAAT TCTGGGGAAGTGGTTGACAATTAGTGAGTT Gene lists Zhang et al., 2013
Marker1455 chr3 15,406,351 15,406,684 - CCCCTTGTTTGGTGGGTCGATGATCTCTCA CAAAACACGTGTTTATCAAGTTTCGTTCAA Gene lists Zhang et al., 2013
Marker14584 chr3 19,521,282 19,521,617 + TTACTGAAATGTGAAATAATTATGGGGTTT TTTGCGCTCTCAGCACTACTGCTCTTCACC Gene lists Zhang et al., 2013
Marker14670 chr3 3,453,978 3,454,314 + CATTATCCTTGATTGCTGCAGTTTCTTTTG AAAAATGACTGAATCCTTGCATCAAGGGCC Gene lists Zhang et al., 2013
Marker14683 chr3 15,207,554 15,207,906 + AACCCCGCCATGGAAGTGGGTGGCCTGACC TTCTTTTCTTCTCCTACTTATTTATAAGTA Gene lists Zhang et al., 2013
Marker15034 chr3 14,716,526 14,716,884 + ATATTGCGCCATATCTATCTGATTATACGC TTTCCTACAAGAAGAAAAGGAGACGTGAAA Gene lists Zhang et al., 2013
Marker16314 chr3 23,118,243 23,118,588 - TAGCACCTGTGGCTCAAATGGCCATACCAG AACGGTAATTCCTTAGGGAGCTGCCTTTTG Gene lists Zhang et al., 2013
Marker1640 chr3 4,959,272 4,959,623 + AATAGAGTGCAGGCATCCCCACACTACTGC ATGGAAAAATAAACAATAGAACCACCGAAC Gene lists Zhang et al., 2013
Marker16886 chr3 14,699,345 14,699,655 + TGCTGGAAAAATGCATTGGGACATCTGTAA AGAGTTGGTCGTTGTAAATTTCTTTTCCTT Gene lists Zhang et al., 2013
Marker16889 chr3 19,720,687 19,721,015 - CTGTCGTTGAAAGGAATAATCAGTTTAGTG ACATTTCCAAACATTGTCAGGTGACTCAGT Gene lists Zhang et al., 2013
Marker17451 chr3 3,571,745 3,572,110 - CGTCAGTTCCTCATTTATTCTAGTCTCTGT TAGCAAAGACTTCTATGTTCCTGAATTACA Gene lists Zhang et al., 2013
Marker17755 chr3 9,794,426 9,794,796 + TATTGGGGGAACATAAGAAAGAAGAGTGTA TCGACAACGGTAGTTCGACTGACATAATTT Gene lists Zhang et al., 2013
Marker18073 chr3 15,252,367 15,252,693 + TACAGGGGGGGTGCATGCATAAATGTTTGG TGGTTGGAGTCGAGCTGATCACATTATTAT Gene lists Zhang et al., 2013
Marker18109 chr3 3,703,649 3,704,019 + TACATAATGGTATCAGGCATTGGATTTGGT CATTTGGAAATCATGCTAAACATCCCCTCA Gene lists Zhang et al., 2013
Marker18128 chr3 14,506,778 14,507,091 + ACAAGGAACCCAAATTTTGTCACTGTGGTA ACAAGGCAATATTTCTATTCCATCAATTGA Gene lists Zhang et al., 2013
Marker18390 chr3 16,862,697 16,863,030 + GCATCTTTCTGTAGCAAAGAAATCCAATAT AGCTCTGTGTAGGTAGTTCCGTGTTCATCA Gene lists Zhang et al., 2013
Marker19483 chr3 19,678,828 19,679,224 + TTCTTGATACAATTTCATAAGCAGCTGATA TCTCACTACTATCCACATTGTAAACAAGTT Gene lists Zhang et al., 2013
Marker19659 chr3 11,797,218 11,797,543 - GAGAAAAATCAAGACACAGTATTCAACTAC CAATCTTGGATCATCATTTTTTTGTGAAAT Gene lists Zhang et al., 2013
Marker19681 chr3 23,443,734 23,444,065 - TTACGTAAATTGAATATTTTGAAGGGGGTG TTCCCAACTATAAAATGCTAACCACTTATT Gene lists Zhang et al., 2013
Marker20058 chr3 15,217,409 15,217,710 - TGATGAGCTGTGTGTTGTTATTGATTAGTG TAATGATTATAGTTGATGTGATATGTTTGT Gene lists Zhang et al., 2013
Marker20205 chr3 12,699,268 12,699,634 - AAGTATCACCCCATAAATTTATAGGACTAA AATTTTGGTCCTAGTCGGGGGCTGGTGTAA Gene lists Zhang et al., 2013
Marker20206 chr3 15,155,102 15,155,413 + CGTAGCAGTAGTGAGATTTATGTGTTTTTG ATGATGAAACTACAGTAAAACCTTTATAAA Gene lists Zhang et al., 2013
Marker20382 chr3 23,930,667 23,930,985 - AGAAAAAGATCTAATAGGAAATTGTTTGTA ACAACCTGCAGTTCCTTGGGACAGTTCGCA Gene lists Zhang et al., 2013
Marker20987 chr3 11,782,423 11,782,733 - ACCTCCTACCGGTTTTTGAAACCTTGAATG TATAACGCATTGCAGTGAGGGGGGACGATA Gene lists Zhang et al., 2013
Marker21188 chr3 4,773,685 4,774,071 - GTTTTTCAATTCTCAAGAGATCTTTCAAAA CATGAAGACGCTGAGGATGGGGAGCTCGAT Gene lists Zhang et al., 2013
Marker21266 chr3 1,7239,292 17,239,660 - GTATCATCCGTCCGAGTAGTTCTGCAGCTG AACATTCTGGGAAAACGTGGGTTTGCTTTT Gene lists Zhang et al., 2013
Marker21330 chr3 3,583,169 3,583,541 - TTTACAAGGAAATAATACGTGCAAGTTTCA GTCATTTACACGCATGTGATTGGCTTGCAT Gene lists Zhang et al., 2013
Marker21907 chr3 17,247,894 17,248,261 - AAAAATATACTTTCTATTTTTTTTTCCCTC TTCTGCAGAACTCGGAATTTATCCTCGCCA Gene lists Zhang et al., 2013
Marker22005 chr3 10,017,370 10,017,677 - ACTTTTCGAGGCGACCTACGGATGCATGTA ATCCGTCTCGAGGAACATGCTTCCCACTCT Gene lists Zhang et al., 2013
Marker22479 chr3 5,103,904 5,104,237 - AAAAAAACAAAAAAGGGTCTCCACTAAGCA CGTGCCTTGAAGTCTTCAAATTTCCGAAAC Gene lists Zhang et al., 2013
Marker22567 chr3 19,691,957 19,692,263 - ATAGCTGCTCACCCTCTTCTTTCAAGGTAC AGTTCATGGTACCCAGTCTTAGTGTCAGCA Gene lists Zhang et al., 2013
Marker22665 chr3 22,113,653 22,114,002 + AGGGTGTACTTGTAATTTTGCAAAGATATA ATAAGATTTTTAGATGTACACCTCACAAAA Gene lists Zhang et al., 2013
Marker22702 chr3 23,934,809 23,935,142 + ATTTTGAAGAGGTGACAATAGACCACACCT TATCAACTGAGCCAGTCATAATTTCATTCA Gene lists Zhang et al., 2013
Marker22739 chr3 19,672,085 19,672,416 + CCAGTAAAGAAATGTCCAAGAAACTATGCC TCAAAGTTGAAAATAAATTATCAAGGGTTT Gene lists Zhang et al., 2013
Marker22837 chr3 13,120,952 13,121,267 - TTTACGTCCTACACACATTTTCACCAAAAA GCATGTTTCAATTCTTCATTCTTTCATACG Gene lists Zhang et al., 2013
Marker23434 chr3 3,546,355 3,546,696 + GGGTTCATTGTTGCATACACATGCAATTAT GTAACTTATTACATTTATAGGTAGATATTT Gene lists Zhang et al., 2013
Marker24359 chr3 23,427,488 23,427,783 - ATAATGGCTGATCTGGTTGAGCTATTGGTT ACCTCATATTTGTCCTAATGTTGTTGAATG Gene lists Zhang et al., 2013
Marker24429 chr3 23,367,628 23,367,961 + GGGCTCAAAATTTGTTCTTGATATTTATAA TTCTTTTTTCTGTGAATTATTACGAAGACT Gene lists Zhang et al., 2013
Marker24557 chr3 14,793,678 14,794,023 - AGGATTGGGGGGGTTCCATTGAGAAAAACG TTTTTTTCATATATATTCCAAAAACCATAA Gene lists Zhang et al., 2013
Marker24769 chr3 25,047,143 25,047,496 + AATAAATAATTGCATCAATTGGTAATCCAA CAAAATCCCTCATTGCCTTTGGCCTCGATA Gene lists Zhang et al., 2013
Marker24821 chr3 18,340,972 18,341,308 + AAATTTCAAACTTTTCTCACACGAAATATA ATGATCGGTCTACACTAAAACCTCTATAAA Gene lists Zhang et al., 2013
Marker25107 chr3 21,916,285 21,916,670 - AAGACTAACCAAAATTAGAGCATGTCTAAC ACTGAAACTGTGACCTTTGGGGCTCTGATA Gene lists Zhang et al., 2013
Marker26340 chr3 15,371,796 15,372,129 + TTGGATTGTACACTTTGTTTCCTTTGCATG ATCCCTCAAATTGAACCTCCCAGTAACAGA Gene lists Zhang et al., 2013
Marker2655 chr3 15,390,856 15,391,226 - TTCCTATACCTCTCTCAAATGCTCAACACT TCAAACCAAACTCGATATGGTACAGTTGTG Gene lists Zhang et al., 2013
Marker27086 chr3 18,320,357 18,320,695 - TCTTACACGTTGAAAAGCATGCGATGCGAA ACTGTCAATTTTGTCCTTACTGTAACTTTT Gene lists Zhang et al., 2013
Marker27208 chr3 11,780,246 11,780,574 + TCTTGCTAGTTCCTAACTATGAAAGTGTTA CCCTTTTTTGGATTCTTTTCATTGCCTTGT Gene lists Zhang et al., 2013
Marker27320 chr3 24,773,178 24,773,496 - GTTGGACTCCTTTAGGTTCGGTAAAATGCA AATATTCATATTCATACTGGTAAGCCGTAT Gene lists Zhang et al., 2013
Marker27327 chr3 3,643,835 3,644,199 - CTTGTGAGAGGAACACTGCATGCTGGCCCG AACTCATCCTCACTTTTCTGTATTTTATAT Gene lists Zhang et al., 2013
Marker28064 chr3 4,849,066 4,849,418 - CAAGTTTTGATCACCAAAACATGATAGATG CAAATGTAAACTGTATATATGGTTTGATCT Gene lists Zhang et al., 2013
Marker28247 chr3 5,036,638 5,037,035 + AGCCTCCAAGCTGATAAAGTTATGGATTGG GTAATGAATGTAACAATATGTATCCCGATC Gene lists Zhang et al., 2013
Marker28332 chr3 3,633,084 3,633,381 - CGATATCTTATTTGAGAAAGTGAATGATGC ATCTAAGTGAAAATTCAAAATACCTATGCC Gene lists Zhang et al., 2013
Marker28334 chr3 3,402,451 3,402,769 + GAAATTTATAACTATAATTCTCCTGTTCAC CTTGTTGTAAAAGAACCTTTCCGTTCCTGT Gene lists Zhang et al., 2013
Marker29076 chr3 23,913,624 23,913,950 - CAAATACATCATTATTGCACCGAGAAGAGT AATTATAAAATGTGTGCATGGTGTATGACT Gene lists Zhang et al., 2013
Marker29103 chr3 14,798,751 14,799,123 - GACATTCTAATGAGAAAATTATTAGACATT GTGCATAATACGCTCCTATTCTCATTATTT Gene lists Zhang et al., 2013
Marker29152 chr3 23,097,606 23,097,900 + AAACATGTGAAAAGATACATGTATGCCAAG AAAAGGGGTATTATGCCTTCATCAGTCATC Gene lists Zhang et al., 2013
Marker29371 chr3 19,506,226 19,506,574 - GGAGGCGCTAAAACAGAAGCGAGACAGCTG GAGCATCTGATTGAACTGCTTGGAAAAATC Gene lists Zhang et al., 2013
Marker29640 chr3 17,238,263 17,238,621 - GGACACTAACAACAGAACATTCTACAGTCA CATACATTTCGTACCCTACATTAGATCAAT Gene lists Zhang et al., 2013
Marker29700 chr3 3,531,470 3,531,843 - AATAAAACAGTAAAACGACTCAGGAAATCG TTGAAAGTGAAGGGTAGGTTTTAGAGGTTT Gene lists Zhang et al., 2013
Marker29742 chr3 23,116,746 23,117,128 - GTGATTTTCATGGGAAAAGCCTTGACCTCA TCCATGAGACTGTAAGGAAAATGAACTAAT Gene lists Zhang et al., 2013
Marker29887 chr3 3,275,494 3,275,807 - TGGTCTGTGAGACCTTTTTTCACCCAAGAA CCCCCTTGATGATGAGGAGGAAATTGAAGG Gene lists Zhang et al., 2013
Marker31333 chr3 16,856,650 16,857,046 + TGATGATAAATTTTCATGTTGTCTTTAGGT TCCGAGACAAGCATCTTGTCTGAGTGTCTT Gene lists Zhang et al., 2013
Marker31367 chr3 23,920,569 23,920,960 + AGTAGAGAAGATGAGGTATGGGAAATGCAC AATTGAAACACTAACGAAATCGTGTAAAAT Gene lists Zhang et al., 2013
Marker31537 chr3 14,825,055 14,825,440 - GGGCATTAGAGTCATTTCGCGATCAGGATC TATCTGCGTTGAGATCGTCTCAGGAGATCG Gene lists Zhang et al., 2013
Marker31843 chr3 19,623,486 19,623,800 + TTATGTCTAGTAGAATGACTCAACAGCAAC GACAACTGTGGTACTATCCATTGGCCTGCG Gene lists Zhang et al., 2013
Marker32143 chr3 1,597,426 1,597,791 - TTTATTATAGTACAAACATATATGTGCAGG ATCGCATGTCCAGAGAGGACACCAAATTTA Gene lists Zhang et al., 2013
Marker32318 chr3 15,381,382 15,381,730 + CATGTTTGGCTGTGTTAGATATGGGACAAG CAAGTCGGGGGAATGTATATGTTTATATGG Gene lists Zhang et al., 2013
Marker3289 chr3 25,054,706 25,055,044 + TAAATATATCGAATGCATGACACATTATCC TTATTCACGTGTTTGATCCAAGAACCTGTG Gene lists Zhang et al., 2013
Marker33648 chr3 4,916,620 4,917,022 - TACATTGAGAATGCATCATTAGATCAATAA TTGCCATCGTAGGTTGGAATGCAACCATCG Gene lists Zhang et al., 2013
Marker33844 chr3 9,863,394 9,863,723 - AATAATAGGAAATGGAGAGTGAGGAGGGTG GTATTCTTTGTTGAAAAATTATCAATATTC Gene lists Zhang et al., 2013
Marker34127 chr3 21,932,264 21,932,570 + TGTTGAGGAACGAACGCATAGGAGTTTGTT CATAACAAGTATGTCATATTCGCTCTTTGA Gene lists Zhang et al., 2013
Marker34651 chr3 23,088,537 23,088,838 - CCATCCTAAAGAAGAAAGGGGGCGTCATGA CAATCACTTCTGTGAGTACTCTTTAGTAGC Gene lists Zhang et al., 2013
Marker34886 chr3 19,606,884 19,607,201 + TGCAGAATGCTTGCATATGGTAACGCTGCA GATACATTTGTCTTTTATTTTCAGACCAAC Gene lists Zhang et al., 2013
Marker35160 chr3 24,603,744 24,604,128 + ATTGATAATGAAATAAGAAGAAAAAAGGTG TGATATGATATGAGGGCCCACTTTCCATCT Gene lists Zhang et al., 2013
Marker35390 chr3 24,304,789 24,305,086 - GTTGAGTAATAAATTAGCATCTGGGTTTGT GACTCTGCTTTTGGGCCTAAGAACATCATT Gene lists Zhang et al., 2013
Marker35844 chr3 9,891,955 9,892,249 + TATTAGGCAGAGGCATTGATGAAAGAGGAA TTTTTTATACAAATCCCAATTTCTTTTTTT Gene lists Zhang et al., 2013
Marker36110 chr3 5,007,151 5,007,493 - GCCTTTTATTTTCAGCCTATTGGTAATTTT CAGTTCATACCGTCGTGACAATATTTTATT Gene lists Zhang et al., 2013
Marker36578 chr3 20,706,471 20,706,860 - CTGTCACTATTATTTTGTGAAGAAACAAAG GAAAAAACGTCTCGCTAAGGAGAGAAAGCT Gene lists Zhang et al., 2013
Marker36861 chr3 50,053 50,403 + GTAGGATCCATCATTCATAGCAATATAAGA TAGATTGTCAATCAGGAGTTTTAGAGGAAA Gene lists Zhang et al., 2013
Marker36920 chr3 9,948,698 9,948,987 + GATTGAATCTTTGGAGTCGGAAGTGTTCAT CGGAGAGCGGCACCAGGGCTGGCTTGGAAT Gene lists Zhang et al., 2013
Marker37423 chr3 4,749,127 4,749,481 - CCAAAAAAAAACTACAAAATTTCGCGAGAT TCAGAAACTCTTCTCAACTAAAATTTTTAT Gene lists Zhang et al., 2013
Marker37737 chr3 4,832,680 4,833,057 + GAGTGTTATTCAGTAAAAAGAAAATACTTC GGTGGTGTACGCAGTAAAATCAACCATTTC Gene lists Zhang et al., 2013
Marker37874 chr3 11,751,182 11,751,491 + ACATTTTGTTCTCATTTCTGGTATGCAAGA AGAGCGACAACGGTTTACCCATGGTAAATC Gene lists Zhang et al., 2013
Marker38080 chr3 14,556,459 14,556,760 + TGGGCTCTCTTATGTTAGCTTATTGGATTT TCGAAATAAAAAGGCATCTGATATATATTG Gene lists Zhang et al., 2013
Marker38087 chr3 5,013,902 5,014,279 + ATTTTCATCGTACACATTTGTGGAGACAAA TGAGCGAAAGCAAACATCAGAAATATTAGG Gene lists Zhang et al., 2013
Marker39684 chr3 23,895,903 23,896,231 + ACTATATGGTCCTATCTACTTTGTAATACG ACGTCTAGCATTCCTGAGGTTTGCTTCAAT Gene lists Zhang et al., 2013
Marker40099 chr3 9,789,392 9,789,698 - AACTAAACAAACTATATATGTCTGAGAAAT AGCCTCCCATTTGTCCATGCCTGCAAACAA Gene lists Zhang et al., 2013
Marker40555 chr3 3,479,999 3,480,356 - CCATCCGAAATCATTGGTGTTCATCAAAAA ACATCAGCAAATTCAATAAATTTTGAATAA Gene lists Zhang et al., 2013
Marker40858 chr3 11,764,371 11,764,685 - ATTGCCCTAAAACACAAATCCAAACATATC GCCTATTTTCTATAGATCTCTCATTCTCTG Gene lists Zhang et al., 2013
Marker41208 chr3 14,867,732 14,868,072 + ACTTTAGGTCACAAACAAAAAACTTCAACA ATGTGGAATGGTTCATATGCAGATCAAATA Gene lists Zhang et al., 2013
Marker41527 chr3 14,706,110 14,706,450 - AATAAATTCGTAAAACAAATTCAGAACTGC AAGATGGGTGCGAAAATGTTGAGGAATGCG Gene lists Zhang et al., 2013
Marker42071 chr3 14,630,130 14,630,535 + AATGGTGAAAAAATCGCTTCCTAAAGTAGG AGAGGTATTTTTGTTGGCCTCTTGATTTGT Gene lists Zhang et al., 2013
Marker42215 chr3 5,037,076 5,037,395 + GTATCAATCAGGTAAAACATTTCCGCAACC ACAACCTAAGTACACTTTCCGTGGGAGGTT Gene lists Zhang et al., 2013
Marker42236 chr3 13,979,528 13,979,852 - AGTTATCACTATAGACGAAAAAATTGTATT GCATGCATATAATCTATAATTACTTACACC Gene lists Zhang et al., 2013
Marker4224 chr3 13,166,897 13,167,249 + CAACTAGTATCATGCTATCAAATGCCTGTC TCGAACTTTAGCCTCTTCAGATTGTCCTTA Gene lists Zhang et al., 2013
Marker42676 chr3 24,107,803 24,108,165 - CATTTGCTCTCTTACATGGCAGCTGACTTG TTACCGTTAGAAAAATTATGAAGGGAAGAT Gene lists Zhang et al., 2013
Marker42729 chr3 19,510,887 19,511,215 + ATTCATAAACCCTACGTTTATATGACTTTC CAATTCAACAGTAGCATCATATCATTCTAT Gene lists Zhang et al., 2013
Marker42785 chr3 13,235,953 13,236,287 - TCCGTTGTATGTTATACTATATGTCAGTGG TGCATCAAGAATATCAGAACCATTTCAACT Gene lists Zhang et al., 2013
Marker4368 chr3 5,041,879 5,042,245 - TCCTTCCATAATAGTGCTCCCAACTCCCTA CTCAAACTGAGGGCAAGTTTGTTGGCCTCT Gene lists Zhang et al., 2013
Marker44502 chr3 17,272,510 17,272,883 - TATATGACATGGTTTCATACCGTTCAACTC AAAACTTGACTCTACAAATCCATCAGAATG Gene lists Zhang et al., 2013
Marker45733 chr3 17,841,841 17,842,143 - CCATTATGCATCAAACAGCAAAATCAAAAC AGAAATGATTGTATGCTGACTTCTTGGATA Gene lists Zhang et al., 2013
Marker45929 chr3 16,763,194 16,763,508 + GAATGGCGTACCATAAATCAAAATAGTTAG ATAAACTCTTTTTTGAGATACTATCAATTT Gene lists Zhang et al., 2013
Marker45971 chr3 13,235,238 13,235,561 - GCCGCAGTCATTTCATAAGCTAATTAGTGT TACGAATGATTTAGGCTAATTGCATAATCT Gene lists Zhang et al., 2013
Marker46237 chr3 17,254,770 17,255,074 - TTCTTTTTGTTTGTCACATTCTGGAATTTT CTCATTGATTTGAGGGTGATGGATAACTGT Gene lists Zhang et al., 2013
Marker46688 chr3 9,913,083 9,913,482 - TTTCTTCTTCTCCCTTTATTGTATTTATGA GCAACATTTTCATTGGAATAGTTGGGTTGC Gene lists Zhang et al., 2013
Marker46811 chr3 19,532,249 19,532,536 - TGAGGATTGCTCTACCTCAATGCTTCTGCA AAATTCGGGTTTGAATCTTCAATCATACAT Gene lists Zhang et al., 2013
Marker47093 chr3 24,124,615 24,124,995 - TGAGCCGTATGTCTTTGCCCTTGCAGACAA CAAGTGAATTATTATCAACCAATTGCTCCC Gene lists Zhang et al., 2013
Marker48070 chr3 3,744,676 3,745,080 - TTGGACAGAGAGGATTCGAGTCCGATACAA AATGCAAGCTTATGATAGTAATCAAGTTCT Gene lists Zhang et al., 2013
Marker48098 chr3 3,657,647 3,657,931 + TTGTCGGAAAGCTTGAACCTCTTGCACTTG GCCAGTGTTGCACTTCTAATCATTCTGACG Gene lists Zhang et al., 2013
Marker48404 chr3 24,847,926 24,848,224 + ACTCATGTGTTTTTGCAAGTGCAGCCGGAG CCCTTTTTCTCCAATTTCTTACCATGTTTT Gene lists Zhang et al., 2013
Marker48808 chr3 14,698,981 14,699,340 + TTTGTTCCGAGATCCATGTATTTCATTAGT AACCGTGCAAGTTCCGGAGCCCAAGAATGA Gene lists Zhang et al., 2013
Marker49131 chr3 2,884,952 2,885,341 - GGGAATTATTGCTATACTCGTTTTTCCTTT AACTCTTGCAACAGATTCCGAATTGATGAG Gene lists Zhang et al., 2013
Marker49197 chr3 4,958,009 4,958,287 + AGCAAAAAAACAAATAGCTAATACAATTAT TTTACTATGAGAAAATGCAACCCATCAAAA Gene lists Zhang et al., 2013
Marker49797 chr3 14,737,761 14,738,083 - AATTGTATAAATAAATAATCTTGCTTTGGA ATTTTTGACTTGGACTGTGGCAGCAGTTGA Gene lists Zhang et al., 2013
Marker50358 chr3 15,212,690 15,213,001 + ATAATTCTAAAATATAGAAAAGAAGAAATT ATCAGAAATAATGCCAGTAAAAGAAGTTCA Gene lists Zhang et al., 2013
Marker50595 chr3 3,611,885 3,612,237 - CCCCCATATCTTCTATTCAAACAACCTAAT CTAAAAATTATAATTATATTATATCATAGT Gene lists Zhang et al., 2013
Marker50769 chr3 24,793,880 24,794,273 + CCTGCGCAGATGGTTTTCAACACCATCGAT ATGAGAAATCTTGACAGACTTGAAATTTTA Gene lists Zhang et al., 2013
Marker52296 chr3 2,914,831 2,915,121 + CAGTCAAGCCCATCTAGATCTTCAAGGATG CCCTCTTGGAGCTAATTGATTTTTAGCCCT Gene lists Zhang et al., 2013
Marker52796 chr3 19,684,848 19,685,221 + AGTTTCCATCAATGAATCAATGACATGCAG ACAGGAAAAGATCAAGCTGACAAAGCTAAT Gene lists Zhang et al., 2013
Marker5306 chr3 25,053,061 25,053,410 - GAAACCAAACCATGGGAGCAATAATACCAG ACTACAACATCTGAATCATGGTATAAGGAT Gene lists Zhang et al., 2013
Marker53743 chr3 24,789,352 24,789,640 + GTTGATACATTGAATGATTTTTCGACAAAA TTTGATTGTATACGTAGTTTGAATCCCGCA Gene lists Zhang et al., 2013
Marker54189 chr3 25,020,182 25,020,471 + TCACTCAACAAATATACAACAAAACTTAGA TACATAAAATAGGTTGACTATTTGATGATT Gene lists Zhang et al., 2013
Marker55339 chr3 25,026,227 25,026,557 + TTTTTATTATGTTCATGGTAATGAAAAGAA CCGTTGTCCATGTTGGCTGTGTTGCCAAGA Gene lists Zhang et al., 2013
Marker57623 chr3 9,931,808 9,932,090 - CAATCGTTACAATCAGTAGGCAGCTGTGCT CATCGAAGGATGCAGAAAACTTGGAAACTA Gene lists Zhang et al., 2013
Marker58710 chr3 24,712,943 24,713,302 - AACTAATTGAAGTAGGAATCAACACAATAA AATTAGATCAATCAATTCTTCAAACATGCT Gene lists Zhang et al., 2013
Marker58797 chr3 14,709,800 14,710,079 - GGGGTTTCAATACAAACAAAGGGCTACGTA AAACATTGAAACAATTCCAGATATTCTTGG Gene lists Zhang et al., 2013
Marker58941 chr3 3,666,583 3,666,971 - GAAATATCTTACCAATCATGCAACTAAAAT TGAAGAAGAATGTGTTACTTTGTGACTTAG Gene lists Zhang et al., 2013
Marker59436 chr3 15,411,445 15,411,748 + ATTTAGAAAAAGCACACAGAAAAAAGAGAC CTTGCCTCCTCTTGTGCAAGCATAATGACT Gene lists Zhang et al., 2013
Marker59790 chr3 4,001,141 4,001,541 + TGCTATGCTTGTGCCGACAAGTAATTCGTT CCGTTATATCAAGATTACAAAATGATACAC Gene lists Zhang et al., 2013
Marker59794 chr3 4,917,289 4,917,670 + AATTCAGTGAATTTGCTCATATTATAAAAA ATATGTGAAAAATATTACATCACGTAACTC Gene lists Zhang et al., 2013
Marker6300 chr3 14,862,516 14,862,858 + TGGAGTAACCATGAAAGTCAAATACTGTGA CCTTATACTCTAATTCACACAAGGAAAATT Gene lists Zhang et al., 2013
Marker6356 chr3 13,836,131 13,836,505 + GTCTTCTTAGCCTGTTGGTCTGCTGCCATC GTAAAATGAGAAGTATCCATTCAGTATCTG Gene lists Zhang et al., 2013
Marker6437 chr3 23,120,695 23,121,028 + TGTACTCAGTTTCCTTCAAATGAACCATGT GATGACACTGACGTGCCAAATGGTCAGGGA Gene lists Zhang et al., 2013
Marker6513 chr3 13,228,977 13,229,315 + AACATATCTTACCAACTTGAGTTGAAATAA TTTGGTATTTTTCGTTTTCAAAGAGCAAGC Gene lists Zhang et al., 2013
Marker7502 chr3 12,263,225 12,263,574 + AATCACTGATAATATAAGGTCTTCCCAGGC ATGGGAGTGGTGATCTATTGGGTAAATCAG Gene lists Zhang et al., 2013
Marker8003 chr3 14,794,947 14,795,302 + CGGCCGAACACTCTCCTTCCAATACGCCAA ATTTCTTGATTGAGAGGTGAAGATTTGGGA Gene lists Zhang et al., 2013
Marker8339 chr3 25,063,434 25,063,782 - ATGATCATATTAGCCATTGTCTGCCTATTG TACAGCAACCACCACTTCCAGTATAATTGT Gene lists Zhang et al., 2013
Marker8587 chr3 19,492,884 19,493,250 + TTTATCATGTCAAAATAAAGGGACAACACA CCAATGCAAATTTGAGTCGACAAATCGGGC Gene lists Zhang et al., 2013
Marker8800 chr3 19,558,800 19,559,144 + ACGTAATGATTACATTGCCATGTTACTATT TGAACTTGTTGTTACCCTTACAAGGATTTA Gene lists Zhang et al., 2013
Marker8859 chr3 3,280,049 3,280,379 - CAGAAGATAAGAACAACTATGGCTTATCGA TTTCACTGACTTTATTCACCATATCTTGAT Gene lists Zhang et al., 2013
Marker9080 chr3 12,279,274 12,279,642 + GTCAGTTGACAGATGATAACATTCTAAAAC TCCAAATGTTGAACAAGAATCAAGAGAAAG Gene lists Zhang et al., 2013
Marker10801 chr4 12,972,159 12,972,519 + AGAGAAACTACTGAGCATAAGAACAACAGA ACCAGTACACCGAAGCTGAAAACATCCGAC Gene lists Zhang et al., 2013
Marker1215 chr4 20,348,979 20,349,310 + GTTCAATAAGTAGTTTGACTCAACAAACAA GGAGATCTTAGCACTGGACGTATCAGTATG Gene lists Zhang et al., 2013
Marker1240 chr4 15,931,551 15,931,872 + TGTTGGGAAAGAGGTCTTTCCTACTACTCC GCCCTCTTTCTCAGTTCCATGAATGGTTTG Gene lists Zhang et al., 2013
Marker1279 chr4 9,961,211 9,961,557 + TTACCAAAATAACTGCACAATGTTTCAATT ATTCTGTTGAATTGGGCTCGTTTTTGGAGT Gene lists Zhang et al., 2013
Marker14624 chr4 8,680,665 8,681,001 - TAAAAAACGCTTGTTACCATGGGTGGTCCT GACTCGCAAGAATCGTCATACGGAAACCTC Gene lists Zhang et al., 2013
Marker14988 chr4 11,660,435 11,660,816 - TGCTTTTGAAGGATGTGATTGTTGTTGTTT TTCTGAACATGTTCACAGAGTGCAATATAA Gene lists Zhang et al., 2013
Marker15038 chr4 20,167,944 20,168,249 + AGGGAAATTTGCCATTGTTTTTTCTCCGTT AAAGCATGAAGAACTCTTGTTTAGTGGGAA Gene lists Zhang et al., 2013
Marker15054 chr4 10,068,732 10,069,096 + TGATAACTAAGTTATGGATGCAAGAGAATA CTGACAATATCACCTGCATTGTCGTAAAGT Gene lists Zhang et al., 2013
Marker15155 chr4 3,505,978 3,506,342 + GCCCTCGAGTTGAGCCTTGTGGGAACCTCT CTCCTCCTCGAGACTCAGGGAGCACACGTT Gene lists Zhang et al., 2013
Marker15864 chr4 20,194,241 20,194,603 + AGAGTGTTTGATGAATATATCCTGCAGGGT TATTTATAGCTCTTGCCTGGCAACCTAAAG Gene lists Zhang et al., 2013
Marker16494 chr4 12,920,677 12,921,055 - AAAATTGCTCCCAGAAGTTATTGCTACCAA CCGTTGGCTGGGGCCCTAGGAGTTGCAGGC Gene lists Zhang et al., 2013
Marker17528 chr4 15,973,879 15,974,163 - ATCTCACAAGTGTTATGTGGAAGCTGTGCG GGTTCGACCCTAACGTCATAACCCACCACC Gene lists Zhang et al., 2013
Marker19040 chr4 20,353,102 20,353,482 + CGAAAAAGGAATTTTTGGAAAGGGAGAGTG TCGGACTCGACCCAAGAGAGGAACCCAATT Gene lists Zhang et al., 2013
Marker19372 chr4 4,299,145 4,299,458 + GAAAAATTCAAGAAAATACTACAATAACCA TGTCTGCAACTCGTCGAGAAGTGATGGGCA Gene lists Zhang et al., 2013
Marker19419 chr4 16,545,899 16,546,209 - TAATCTAATACTACGGTAGCTCGCTTCTGT GCCTCCTACTTTCGCTGCCCCAAAATATCG Gene lists Zhang et al., 2013
Marker21327 chr4 16,687,114 16,687,424 + CAAAAATGCAATAAAATGAGAATAACAGCA ATATCAACTAAAGCAATTCCATTTTTCCAC Gene lists Zhang et al., 2013
Marker22116 chr4 20,422,247 20,422,643 + TTTAGGGTTGGTTTCAATTATCTCTCGCAC AGTTCATTCAGGCGATCGAGGACAATGAGC Gene lists Zhang et al., 2013
Marker22707 chr4 16,432,493 16,432,827 + GTATTTGTGGTTGGAGAATAAAATTGATTT GTAATGGTTACGTACAAGTGACCAACATCG Gene lists Zhang et al., 2013
Marker22782 chr4 20,293,256 20,293,609 - GGCTTGGTCAGCATGACTAGGATTCCTGAT AAACACATCTCAAGTTTCAAGCATAGTTTC Gene lists Zhang et al., 2013
Marker22966 chr4 10,480,153 10,480,514 + ATTTCATTTCAGTAAAATCTGCTGCACTGT GTACAATTAGTGTTACAGATGAAAGAAATC Gene lists Zhang et al., 2013
Marker23193 chr4 20,155,469 20,155,776 + GTGTGATCTGGAAAAGACAACACATAAAAT ATGCTTGTTTCTGGAGAGCAAGTTGCTCCT Gene lists Zhang et al., 2013
Marker23322 chr4 19,993,987 19,994,363 - CAATTGAGTCGTACATGTCCTCCAAGAGTT GTAAGTAATTACACACCAGTGAGTATTGTT Gene lists Zhang et al., 2013
Marker24154 chr4 10,024,022 10,024,346 + ACTTATTTTATCTGGGAGAATGTCACTCTA TTGAATGACTGGAATGAAGTCATGGAAGAG Gene lists Zhang et al., 2013
Marker24456 chr4 19,727,254 19,727,608 - ACGTTCTGGGGTTGATTTAGTGAGTTACTC AGCTAAACTGGCTCTCCCTCAAAGACGCCA Gene lists Zhang et al., 2013
Marker26114 chr4 13,344,402 13,344,687 - TTTCCCTTTTTTTGGCTGAGCAGTGGGATA GGTTTCCGAGGACTGATTTTGTGGACCATG Gene lists Zhang et al., 2013
Marker26618 chr4 13,405,877 13,406,239 + TCCCCTCTTATTTTTTGAAACTAATCCCCT CAGGCACCTGAGTAATTGATTACAGTATGT Gene lists Zhang et al., 2013
Marker27072 chr4 16,505,602 16,505,929 - TAGCATGAAATCATTCCATTTCATAGATCC TATTTTCAGTTATCTATACTTTTTCAGGTT Gene lists Zhang et al., 2013
Marker30158 chr4 11,980,577 11,980,952 + TGTCATATACATAACAAATATGCGTATTTG ATTATTTTTAGTATTGATTGATTATTATGT Gene lists Zhang et al., 2013
Marker33223 chr4 20,157,112 20,157,504 - ATAAAACTCTGAAGTGGGTAGATTTGTTAT CACATTACAAAAATTGGAAGAACCAAATAA Gene lists Zhang et al., 2013
Marker34683 chr4 11,668,470 11,668,824 - TTATCTATAACCGGTATCGGTGTAATCAAC GACATTACATGCATCATCAAGTTGTTCACC Gene lists Zhang et al., 2013
Marker35329 chr4 3,369,847 3,370,190 + TATAAGTTTGCTCGTAGGGATTTATGAAGA CTATTTGCAATATATACCTGACTTTGTTAT Gene lists Zhang et al., 2013
Marker36630 chr4 16,638,432 16,638,774 - TATTCAAAAATCCACATAAACTGTATCCAG ATATGGAGGGCGACAATGATTAGTCTTTTA Gene lists Zhang et al., 2013
Marker36944 chr4 8,226,526 8,226,820 - TCAACAAAGAAACCATTTTTTATCCAACCA GACTAATCCTGTATTATTGGAGCTGAAAAT Gene lists Zhang et al., 2013
Marker36983 chr4 16,667,934 16,668,227 + TGAAGCTGGCTGCTCACTCTGGCGCCGTTT AAAAACAAGAAGAAGAAAAATCTATTTTGT Gene lists Zhang et al., 2013
Marker39070 chr4 12,919,407 12,919,735 - AAGTGAAGATTCTACAAGTTGTTCCAGAGA TGCCTGGTAAAAAAGTGGACTTTTTTATGG Gene lists Zhang et al., 2013
Marker39483 chr4 6,149,453 6,149,770 - TGCATGATTCAAGACAGAAATATCCTTGAA TGGACGACAATCAGTAATCAGGCAAAACAA Gene lists Zhang et al., 2013
Marker40400 chr4 20,406,173 20,406,468 + CACATCACTCTCTAACATGTGCACTCGTTG CTCAACCATATCAAACTGGGTTAGCTTTGA Gene lists Zhang et al., 2013
Marker41400 chr4 19,683,250 19,683,563 - ATTCCCTGTTGAATGAACCCGTTACCGATG AAATACCAGGCTACAGGAAATGTATACAGT Gene lists Zhang et al., 2013
Marker41749 chr4 20,374,511 20,374,803 - AGAAACCCAATACGGAGTAAATGAATCAGA GTGTGAGAGAGTGTAGATGAGTGAGGAGAT Gene lists Zhang et al., 2013
Marker42540 chr4 11,390,341 11,390,653 - TTCCTATTTATTTCGTAATTTTTCTCCCAA GTTTTCTTTGTATTGTGCCTTGTATTGCTG Gene lists Zhang et al., 2013
Marker43245 chr4 3,496,267 3,496,579 + AAGAAAGTTTCACAAAAGATAAACCAAAAA AGAAAAGACTAATTTTTATAATTTCACTGA Gene lists Zhang et al., 2013
Marker43535 chr4 13,393,703 13,394,071 + GAGGAAGTTAGAAATGGAACATGGTAGTTG TGGTTATAAACTGCAAAAATAAGTTATAAG Gene lists Zhang et al., 2013
Marker46861 chr4 20,405,762 20,406,168 + GCATATGGCCTCTCACCGTTTTATTGTCTC GCAATCGTTACAACCATTTGTTTCCCAGAA Gene lists Zhang et al., 2013
Marker46964 chr4 13,003,176 13,003,470 - TGCGCCTTTGCGTTAGCACGCGTTTTTGGG TTTCAAATGGAACGTGCAAATGTAATTTTT Gene lists Zhang et al., 2013
Marker4732 chr4 3,490,972 3,491,320 + AGAAACAGTGGGAAGAAAATTAGGAAACGA CAATTTCCTCCAGGTTCTCCATTTCTTCTG Gene lists Zhang et al., 2013
Marker4876 chr4 9,518,642 9,518,975 - AGAAAGAAGTTTTTGATCCTCCGAAATGTT AAAAAGGTGTACATAGTTTTATAAATCGTG Gene lists Zhang et al., 2013
Marker48999 chr4 9,414,067 9,414,447 - ATTTCTTGTCCTAAATGACGTTTCTAATTG TTATGGAATAAACTAAGTGATTTAGATTTT Gene lists Zhang et al., 2013
Marker50028 chr4 16,649,413 16,649,704 - TCCATCGATACATTATTTTTTGTTGTTGTC GATTAGGTCGAAAGGTTAGATCTCAAATGT Gene lists Zhang et al., 2013
Marker50206 chr4 7,896,211 7,896,611 - AGATCTAATTCTGCATGGTCGCGATGTAGA TCACAGATATCATCTTCGGAGATGTGTTAG Gene lists Zhang et al., 2013
Marker51004 chr4 14,814,613 14,815,011 - TTTTGGTAAGCATTCAAAAACTATACGAGT AAGAACGTTTGTCAGATCCTCTTGGGCCTC Gene lists Zhang et al., 2013
Marker52894 chr4 16,327,661 16,327,954 + AAATTTTCCGTCTATTACCAAAATCAAATA CTTTTTATTGGATGAGACACGCACACAACC Gene lists Zhang et al., 2013
Marker53318 chr4 13,366,313 13,366,610 - TCACATCGATATATGTAGAGTTCAGAAGTC CTATAAGAAAATGGAGAGGAAAATATATCA Gene lists Zhang et al., 2013
Marker53673 chr4 16,686,750 16,687,043 + TTTGCTCTTCTCCTCTAAAAATTTGTTCTT CAAAGATGAGAGAAGATGCTAATTTTCTTT Gene lists Zhang et al., 2013
Marker5436 chr4 13,410,742 13,411,067 - CCACTTTGATATAATACTTTACCAAAAATC CATATTCCTTTTTGCACACATCAATCACAA Gene lists Zhang et al., 2013
Marker54728 chr4 12,922,763 12,923,088 + ATCCAACAATAGATGATTCAACTAATTCAC CGTTTGAGTCTGAGGAGAGACTCATGCTCC Gene lists Zhang et al., 2013
Marker54828 chr4 20,334,732 20,335,026 - TGCTCCCAAGAACTGAAAGCGCAGTTTTTT TTCCTTTTTACGCTCCTTCTTTTTGACTTG Gene lists Zhang et al., 2013
Marker5487 chr4 15,942,438 15,942,764 + GAACCCAAAAAATGTAGAAAAAGGATAAGA CACACGCCATCATGGTGTCGCATGCAATAA Gene lists Zhang et al., 2013
Marker5549 chr4 20,250,174 20,250,548 - AAATATAGTAGAACTACAACCCAGAACCTG CATACTTGGAAAAGATCTGCAATTTGAAGG Gene lists Zhang et al., 2013
Marker55756 chr4 20,176,544 20,176,816 - TGCATGTATGCGTGTAAAATAATGTCTTAT GTGGGTATGATATACCCCTATCACTAAGTT Gene lists Zhang et al., 2013
Marker56149 chr4 20,346,004 20,346,284 - CCCAGTTTACTTACCCGGACTTCAAACAGA AAGAGTAAAAAGTTTCCCAGATTCAGCCAT Gene lists Zhang et al., 2013
Marker56395 chr4 19,644,597 19,644,894 - GACAAAACTTGACCCAGTGTCCAACCTGCC TTGACGGTAAAGTGTAAAAACAAACATAAT Gene lists Zhang et al., 2013
Marker6969 chr4 16,424,228 16,424,549 - CTTGGTGCTACTTATTTTATATAACCTATT AGAGTTGGTGGCATTGTATGGGTGTGAATA Gene lists Zhang et al., 2013
Marker8465 chr4 3,540,996 3,541,346 + GGAAGACCAATGACTTCACCTGGGATGAGA GGCGAACATGTCATACAACTTGCCAACATA Gene lists Zhang et al., 2013
Marker8927 chr4 12,816,456 12,816,813 + AAAGTAACGATTTAGGAATCAAATCCGTAA CTTGCATGTGCCCCTAACATGGTAGGTCCC Gene lists Zhang et al., 2013
Marker10478 chr5 8,672,258 8,672,629 - TGCCGATGGTGATTGTTCACCGTTACCCTA GTTATACTTACATCCTCACTTCTTCTTCTC Gene lists Zhang et al., 2013
Marker14369 chr5 3,150,456 3,150,820 + GCTGCATCTACAGTAGTTCCTGAAGTGACG TACTAGTTCTTATCTAATCTCATCCAACAT Gene lists Zhang et al., 2013
Marker14393 chr5 7,521,110 7,521,483 + AAAAGCTCTAGTAGATACACCTTACCAGCT ATTAGGAGATTACTTAGTTGGTGTCTATGA Gene lists Zhang et al., 2013
Marker14754 chr5 9,276,270 9,276,620 + GAATATGCAATCCTTTTAGTTGGGATAAAC GAACAATCTGAAAGCTTTCAAAACCTATCT Gene lists Zhang et al., 2013
Marker14768 chr5 8,952,210 8,952,542 - CTCATATTTTTTATAACCGCCTTACTAAAG CCGATGAAGCAAGATCTCCTACTCTAAGGA Gene lists Zhang et al., 2013
Marker15336 chr5 9,707,426 9,707,766 - TAACAAAATTTGATTCTTGAGAATGAGATG TTGGAGAGGATGATGCAATGACTTCTCGCT Gene lists Zhang et al., 2013
Marker15626 chr5 8,523,956 8,524,290 - GCTTTGTGAAATATACTACTACAGTCATAT ATCTTGCCCATGATAGATAATTGTTGTCGT Gene lists Zhang et al., 2013
Marker1591 chr5 8,045,123 8,045,469 + CTGATTGAACTAACTCGTGGGAATCGTAAT TTCTGTATCGATCAATAGAGTAAATACATC Gene lists Zhang et al., 2013
Marker16754 chr5 8,731,160 8,731,533 + AGGAGAAAGATCCTGAAAAAATGTCTGAAA TAATGAATCTTTACGGACAATTTGGCCCCA Gene lists Zhang et al., 2013
Marker16784 chr5 3,139,908 3,140,281 - GGACCTCTACAAGCCCACCACTGCCAGGCA TCCAATTGCGGAAAATCTACCTCTCAACAG Gene lists Zhang et al., 2013
Marker16826 chr5 1,564,223 1,564,550 - TGCCTGGATCTTGGCTTTTGCGTTGTCTAA GTCATATTGTCATCCAATCCTTCTTGTCCT Gene lists Zhang et al., 2013
Marker16948 chr5 3,153,558 3,153,869 + AAGTTCAGTGGCTAAATGCGTGAAGGTCAA TACGAACTGTAGGGCAGTGTTGGCAATAGC Gene lists Zhang et al., 2013
Marker17748 chr5 8,039,819 8,040,174 + CATGGCTCTATCTACGATGGTGCTCCAGAC AGCGGAAGCGGTGATAACAAAATGCATAAA Gene lists Zhang et al., 2013
Marker18050 chr5 9,695,972 9,696,341 + TAGAATGTAACTCAGAACTAATCATTGAAA GAACTCATTGGCAAGCTTTGGATAGGGTAC Gene lists Zhang et al., 2013
Marker18142 chr5 8,041,327 8,041,709 + TACTTGAAATCACATTATGCCAAATTGCTC CGCTTCCATATGACAATCCCGTGAGTCAAT Gene lists Zhang et al., 2013
Marker18233 chr5 8,736,981 8,737,339 + GAAACTCTTCTCGACCCTCAATGGCACCTG GAACAAAGCATAAAAGGAATCTTACCTGTA Gene lists Zhang et al., 2013
Marker19206 chr5 8,524,822 8,525,150 + AACTGCAAATGACAAAAGCCTTTCATAAAT TACTAAAACATGTCTTATATGTGCCCACAT Gene lists Zhang et al., 2013
Marker19532 chr5 3,975,762 3,976,103 - GTTGGTTATGAACTTGTGTTTTCTGCTAAT GTTTTTAGTGTAGACGTGTTTTTTTTATAT Gene lists Zhang et al., 2013
Marker19621 chr5 573,741 574,073 - GGAAGGTGGGCGAGGGACAGCATTGTGATA TGGAAAATAGTATTTTTATTTTGAAACTAG Gene lists Zhang et al., 2013
Marker19802 chr5 8,414,136 8,414,532 - ATCAGTTATTGCTATGGAGGACGTTATTGA ACATTGGGGCACTCAGCCAAGGAGTGTGCC Gene lists Zhang et al., 2013
Marker19912 chr5 9,876,284 9,876,673 - TCATTACAAAACAGCATATTATATCAATTT ACCTGCTCTTCTGCCTCGAACACAACGGGG Gene lists Zhang et al., 2013
Marker20103 chr5 2,768,361 2,768,746 - CTACAATGGCTGCATAGATTCGTATATTTT AAGATTTTGCAGTAGACAATCTATATACAT Gene lists Zhang et al., 2013
Marker20350 chr5 2,208,779 2,209,130 - TGGATCTCTGAAACAATTTCTGCAGAAAAA TTTTACAATTAGATATTCGAATAAGAATTA Gene lists Zhang et al., 2013
Marker20363 chr5 4,010,058 4,010,366 + ATATGTGGTATTATATTGCTATGCTAATCA ACAGAATGCATGGCTGCTCATGGTGCTGAA Gene lists Zhang et al., 2013
Marker21350 chr5 8,960,359 8,960,655 + GTGTCGGCATTCTTCAGTCGAATGACCGTA TTTTCTTTTTGGCAGCTTGGGCATCCCATG Gene lists Zhang et al., 2013
Marker21666 chr5 8,897,698 8,898,054 - TTGCCTTTACTTACCTCACTCTGATTCTAA CTACAAAGATATGTTTTACAGTATAATTAG Gene lists Zhang et al., 2013
Marker22397 chr5 15,056,593 15,056,917 - TAGTTTATTTGAGCTTAGTTTATCAAATAA AACCCTAATCAATGATTGCATAAAAGAAAC Gene lists Zhang et al., 2013
Marker22740 chr5 9,425,970 9,426,339 - CTTATGCTATTTCATTTTAGTTCCGTAACT TTACCCCTCTACTACTTTCAAGTGTGAATT Gene lists Zhang et al., 2013
Marker23167 chr5 3,799,798 3,800,114 + TTGTCTGGAAAAAGGAAGAAGATAAGATCG TGGTTATGAATGAATCTTCTACCCCCTTTT Gene lists Zhang et al., 2013
Marker24005 chr5 8,839,618 8,839,994 - ATTCTTCGAAGAAACACACGCCGACTGGAA CACTCCACACGCCAACTAAAAAAGAGGCGT Gene lists Zhang et al., 2013
Marker24326 chr5 10,570,463 10,570,815 - AAGATTTTTCCTATTGAGCAGTAGATACAA CAATCACCTACCCTTTGGAGGAGAATCATC Gene lists Zhang et al., 2013
Marker24503 chr5 4,165,646 4,166,007 - GTTTCTATTTTATTTGCTGCTAATGGAAAA GCAAGACGAGTAGTCTATAAAGTATAAACA Gene lists Zhang et al., 2013
Marker26855 chr5 7,999,763 8,000,100 - TGCCCATTCTTGAGGTACTCGACTCGGAAT TGAAGGAATATTATTATGTACCTAGCATGA Gene lists Zhang et al., 2013
Marker26921 chr5 8,300,404 8,300,761 + AATTTTTTCCTACTAAATGAAAGAGAGAAG TGATCCTCAAACTATGGAGGAATGTTACAC Gene lists Zhang et al., 2013
Marker27050 chr5 9,650,662 9,650,990 + GAATCTTAGAAAGATAGTTGAAGTTAGTGA AAGGATGCCAAGATTCTCGCTGGCGGTGGT Gene lists Zhang et al., 2013
Marker27901 chr5 7,555,165 7,581,734 + AAGGGGGAGGGACAAGTACATCTTCATTTT GCGTCAATTTGAAATAAGGTATAATTACGA Gene lists Zhang et al., 2013
Marker27918 chr5 9,344,408 9,344,756 - TAAATTAGAAACTTCAACTGAATCTACCAA AAAATAATCATGGAAGAGCATATGTATGTT Gene lists Zhang et al., 2013
Marker27922 chr5 8,799,035 8,799,393 + AACTATCACAAAACATCTAATCAAACACAT CTCGCATCGAATCATGAAGTCGTCGTAATT Gene lists Zhang et al., 2013
Marker28272 chr5 9,797,266 9,797,559 + GACAGCAAAAAATAAATCATCCCTAACATA ACGTGCACAGGTCTTCAATCTCCTCTTCCG Gene lists Zhang et al., 2013
Marker28463 chr5 1,530,156 1,530,539 + AATCCCAGATAAAAGTCTTGTCGATAACGC TACCAAGTCCAGGCGTATAGGTATAAGTTG Gene lists Zhang et al., 2013
Marker28775 chr5 8,987,917 8,988,218 + AAAGTCGCAGTGTCGCAAATAGGAATCCCA CAACAGTCAAGGGATTATGCACCTTTGGAA Gene lists Zhang et al., 2013
Marker29540 chr5 8,185,378 8,185,709 - TTGCATTCCGAATGAGCCATGAGATTATTG AGTGAGTTCTCCTAAGTGCTCTAAAATAGT Gene lists Zhang et al., 2013
Marker29666 chr5 6,182,328 6,182,725 + AAGGAAAAGGTTCACAAGCAATCTAAAAAA TTGCAGTATTTCTAACCTATAAAAGGTTTG Gene lists Zhang et al., 2013
Marker30251 chr5 16,423,246 16,423,595 + ACTAGTACTATATAGACACAAAAATTCTTG TTAGAGGGGTTGTTTGGGATTGTTTCAAAA Gene lists Zhang et al., 2013
Marker30874 chr5 3,161,921 3,162,243 + CTCTGTTTACCCTTTAGGTATGCGCTCCAT TATATGGATAATAGAAAAAGAATTATTTAC Gene lists Zhang et al., 2013
Marker30999 chr5 12,619,878 12,620,268 + ACATTTCGCATATAATTTTGTGGTGCACTA ATGTTTATTGCTTCTCTACAAGTTTATTAC Gene lists Zhang et al., 2013
Marker31940 chr5 16,428,209 16,428,533 + AGAATCTTATAAGAATATGAAGGGAAATTG AGAGGAAAAGGAATTACCTTGTGTTTGCAT Gene lists Zhang et al., 2013
Marker32091 chr5 9,217,769 9,218,098 - ACAGGATAAATAATTGAATGAAAAGCGAGG AAATAACTAATAATCCAATTACTCACGTAA Gene lists Zhang et al., 2013
Marker32428 chr5 9,465,650 9,465,990 - TTGCAAGAAAAATATCTCGTCTCCGTATAA TTCAGTGCAGTAAACTTACATTGCAATTCA Gene lists Zhang et al., 2013
Marker3275 chr5 3,554,477 3,554,819 + ACAAAAAATGAGTTTGCAAGATAAGCAGGA AGATCCATTGTGGAGCCATACTTGTCCTGA Gene lists Zhang et al., 2013
Marker33086 chr5 16,434,013 16,434,339 + TTTCCAGCAACTGTGATTGAACTTTGAAGT GTACTAGTATTGCTCTCACAGTCACTTATC Gene lists Zhang et al., 2013
Marker33183 chr5 8,885,219 8,885,561 + ATGTGAAAAGTCAATATATTCAAAAATGAA AAACAAACGTATGTTTTCACTAAGGTAAGT Gene lists Zhang et al., 2013
Marker34216 chr5 12,765,006 12,765,400 + TGTTTTCTGTTGTACATGAAACTATGCGAC AGCTTGTACTATCGGATGTTGTACTAAATC Gene lists Zhang et al., 2013
Marker34745 chr5 9,851,549 9,851,891 - ATTTCAAGTTTCCAATTGGTTAGTTTCGTT CTCTTCAATCCATTCCAAATAGAGAAAAGT Gene lists Zhang et al., 2013
Marker35306 chr5 3,802,914 3,803,230 - TATAAAAATCGGAAAAATTGGGTGCTATCA TTCCAGCTACAGGAGAACATGTCTTGATTC Gene lists Zhang et al., 2013
Marker3536 chr5 8,132,222 8,132,561 - GCCCGTAATGGACTTGGAAAGAAATAGCAT TGTTTAGGGTTAGTTTTGAAATATTCCAAG Gene lists Zhang et al., 2013
Marker36676 chr5 8,259,970 8,260,269 - TCCTTGAGATCGCGGTACGCCACTTGACGT AGTGATTCCTCAAGTATGAGGACTACTCCC Gene lists Zhang et al., 2013
Marker36813 chr5 7,669,848 7,670,229 + TAGCACAACTTTGCAAGTGTCGATGCAATC TTATTGCCTTGCTAGAGAAATTATTATCAA Gene lists Zhang et al., 2013
Marker37050 chr5 8,404,379 8,404,777 - AATAGATATTGATGTGTATGGTCCAAAAAC TACAAGCAGTATCCCCTAATGGAGACACCT Gene lists Zhang et al., 2013
Marker37842 chr5 554,480 554,826 - GTAGATAAATATAAATTATGGTGAAAAGAA AGCCCAAAACAAAACAAGAAGAAGAAATCT Gene lists Zhang et al., 2013
Marker38196 chr5 2,768,751 2,769,062 + CATCTGAAAATCGATGTGCTGGGAAAGAAG TCTTTTGAACTTCGAATCACCCAAACAAAT Gene lists Zhang et al., 2013
Marker38204 chr5 9,205,546 9,205,866 + GTAGCAGTCTACACCTGGATCTTTTACTTT GGCTTTGATGTCTCAACCACTACAGTTGCT Gene lists Zhang et al., 2013
Marker38637 chr5 8,466,540 8,466,948 - TTAGTCCCTGCCAGGCGGCATTCATACCCA GGATGGGCGCTTTGCATTTCATTGGAAAAG Gene lists Zhang et al., 2013
Marker39604 chr5 2,987,980 2,988,358 + AGAAATGCTAAAAAAGTAGAAGTATAGCAG TGTGTCCATTATAGGCAATAAGAATTGGAA Gene lists Zhang et al., 2013
Marker39637 chr5 12,622,434 12,622,765 + ATACAACTCCAAAAAAGCAAATTCTGCAAC CACTGCTTAGAGCTTCTCTTCGTTAGATGT Gene lists Zhang et al., 2013
Marker40249 chr5 8,526,685 8,527,087 - ATATATACATGAACCTTTTATGAACAGGCA ATCTATCAATAGTGCCATTAGGATTGAGCT Gene lists Zhang et al., 2013
Marker40757 chr5 1,534,343 1,534,671 - GACTGTAAAATGCATAGTCTTCGACCATAA AATCTCATTCTTGTTTTCTCTATTTGTCTT Gene lists Zhang et al., 2013
Marker40763 chr5 12,537,883 12,538,213 + TTCATATCAGCAATAATTTTACTGTAATAA TTCTTGAATCTTTTTTGCATATAAAGTTTT Gene lists Zhang et al., 2013
Marker43434 chr5 8,021,761 8,022,068 + TCTCCAGTTGGCAAGTGCTTGAATTTTCAG TAGTGTGTCAAAGATTTGATAAGAGGAAAA Gene lists Zhang et al., 2013
Marker43532 chr5 8,991,931 8,992,325 + CAACCATGTCTAGATATTCGAGTTGGTCGA CCATTGTTAGGTCAAAAAGTCATATTTCTT Gene lists Zhang et al., 2013
Marker45501 chr5 9,772,768 9,773,165 + TCTTTTTCGGGCATTCGATGTACAAAATAA TTGCCTTTTTTACTTTGTATTATGATGTGC Gene lists Zhang et al., 2013
Marker45638 chr5 9,230,406 9,230,703 - TTTATAAAATCCGCCTAGATGTTCGTCTCT CTCATCTGGCGAAAAACAGGCGTCAGTGCC Gene lists Zhang et al., 2013
Marker48038 chr5 3,944,689 3,945,005 + CAATCTCACTACATGTTTGGCTTATAGTTT GATAGTGATGGTGAAAGAGTTTGATTAGAT Gene lists Zhang et al., 2013
Marker48121 chr5 8,790,403 8,790,755 + TTTATCACGATTTTGATTTTGAGCTATATT AGGAACATGGAGTTGATATCAATGACACCT Gene lists Zhang et al., 2013
Marker48724 chr5 22,18,382 2,218,705 - TTTTATGGATAATTACACTCCCCTATTTGG AATATAAATTTTCATTCACTTTATTTTTTG Gene lists Zhang et al., 2013
Marker49838 chr5 8,900,808 8,901,139 + AGAAAGTAGAAATATGATATCTTCATTTTT AGATACAATTTGTCTATATGACATGTCTTC Gene lists Zhang et al., 2013
Marker50311 chr5 608,749 609,121 - CTCTGCTGAATAATGGATCAACTGTGCTGA AGTAGCTGCTGTTTCTTTGTATAGGTTTTT Gene lists Zhang et al., 2013
Marker5123 chr5 7,579,581 7,579,936 - GGACACTCATCCCTTCTTGTTGGGACAAAC GAACGAGTTGTAAACTTTCAAACCTTGCTT Gene lists Zhang et al., 2013
Marker5391 chr5 8,904,798 8,905,153 + GAGCAACTAGGGCATAACAAGGAAGTATAC ACCTACCCTTCTTCAAAGCTCTAAGAAAGG Gene lists Zhang et al., 2013
Marker54105 chr5 7,584,388 7,584,686 + AGCATTGATCACTCCAAACGAAAGGGGGAA TTTTGCAAGACAAAGAGCGGCCTTCCCTTA Gene lists Zhang et al., 2013
Marker59357 chr5 6,427,139 6,427,551 - AATTCAAATCTCATCGGCCTAGGGCATTGA CCCGAATAATTTTGCACGACTTTGTAGGCC Gene lists Zhang et al., 2013
Marker59536 chr5 7,581,705 7,582,007 - TTGTAGTTATGCCTTATTTCAAATTGACTC AAAATGAAGATGTACTTGTCCCTCCCCCTT Gene lists Zhang et al., 2013
Marker6189 chr5 8,680,780 8,681,129 + ACTAAACACAGAACAACATAAACAACTACA GCCGTCTCAAGGACCGTTCCAAAATCTAAA Gene lists Zhang et al., 2013
Marker6325 chr5 9,693,823 9,694,170 - GCAAAAAACTCTCACTAACTAACACAGAAC TTGATAGTTGCCTGCCCAATTGTAGCCTTT Gene lists Zhang et al., 2013
Marker6470 chr5 4,007,104 4,007,456 + AGTTCAGTTTTTCACTAGAAATATATTAGA GGGCTTGATCAGGTGTAACACTGGTGCTGC Gene lists Zhang et al., 2013
Marker6635 chr5 549,337 549,662 - GGATTTGGTTGGTGCAATCACGTGTATGTT ATATGGTCTAATTTGCGTAGTGCAGGAAGG Gene lists Zhang et al., 2013
Marker6675 chr5 8,862,005 8,862,378 - GTCTAAGTGGGTACATAGTAGGGCATCATT AGTCATTCCTGCAAATTATGTTTTTCCAAA Gene lists Zhang et al., 2013
Marker8869 chr5 12,666,775 12,667,110 - GCTCATACATCATTTTTTATGTCAAAAAAA GAGAGTCCTCTTTTCTTAGACTGGCCACAA Gene lists Zhang et al., 2013
Marker8966 chr5 9,299,159 9,299,511 + AAGTTGGTACCATGCAACTTCCCTAAAGAG AGAATGCAATAGATATGACATCTATTCCAG Gene lists Zhang et al., 2013
Marker9417 chr5 8,000,459 8,000,822 + GAACAGGATCTGTCCCCTATTATAACGTGA CTTTCTTGGTCAAGGATTGATCGAGAATTA Gene lists Zhang et al., 2013
Marker9720 chr5 9,197,667 9,198,015 - ATTGCATAATCTGTTTGCTATAAAGAATCT TGTCAAGATCATTGGGAAGCAGCCTTACAC Gene lists Zhang et al., 2013
Marker10452 chr6 2,873,354 2,873,673 - TACAAAATGGCGCATCGTATGCACATCTGC AATAAGTGGTATACACTGATAGTTACACTG Gene lists Zhang et al., 2013
Marker10789 chr6 16,699,499 16,699,864 - AGATGGGACTGGAGCATCTGGTCATTCTGG ATCTTTGGACAGTGTTATTTTTTATTACGT Gene lists Zhang et al., 2013
Marker10866 chr6 16,938,472 16,938,791 - GGAAACCTATGTTTCTTATAGCAGGAAAGA ACACATAGGTTCACAACCTCGCATATCACT Gene lists Zhang et al., 2013
Marker11409 chr6 16,501,706 16,502,070 - CGATTATGGTAGAGAAAACCACTATGCTTA AAATGAATGGCATTGGTCTGCGAAAGATCC Gene lists Zhang et al., 2013
Marker11981 chr6 16,525,618 16,525,984 - TTGATGAACAACTTCCTGCATGTCCATATT AACATACAATTGCATGCTGTTTTTACTTGA Gene lists Zhang et al., 2013
Marker12171 chr6 18,253,202 18,253,563 + CACATACACGAAGGATTGAGGTGTATGCGA TTAGCTTATTTTGTGACCAAATGCTCCTAA Gene lists Zhang et al., 2013
Marker12593 chr6 21,606,055 21,606,417 + CATCAACACAATTTGGTCTGAAATACTCTA TAGAAATTACAACCACAACTTCAACAAAAC Gene lists Zhang et al., 2013
Marker13341 chr6 15,960,952 15,961,310 - ATAACAAACCTTGTGATGGAAGCTCATAGC TCCTGGAGCTGCTGCTGACGAGTGCGGGGA Gene lists Zhang et al., 2013
Marker13456 chr6 15,114,590 15,114,919 - AAATCATGCTCAATGGGTTTGCATCACTAT GGGAGATATGTGCATGTATGGCACATATAG Gene lists Zhang et al., 2013
Marker13537 chr6 11,591,605 11,591,921 + CCTCGGAGGTGCTGGGTTGACTTGAAACAA CTCTTTAGATTTTTTCCGACAACTTGGGCA Gene lists Zhang et al., 2013
Marker13632 chr6 15,936,747 15,937,077 + TACCAGCCTACTTTTGGACCCAGGGGATCA GGTAAACAACCTCCGATCTCAGCCATGCCC Gene lists Zhang et al., 2013
Marker14184 chr6 21,456,828 21,457,147 + GGTCTTTGATGCTTGATTTTTCAGGTATTT TTTTATCGTATGCTTCCTAACTTCACATCT Gene lists Zhang et al., 2013
Marker14253 chr6 17,024,231 17,024,629 - TGGCTTTTAGCTGCCATGTGACTATATCAT CGTTCTGATCATAAACTCTGCATGGATGCT Gene lists Zhang et al., 2013
Marker1475 chr6 18,042,277 18,042,646 + GATCACCAACTCTGCATCCAAACACTGACC TGTCTGTTTCATTACAAGAACATGGATAGT Gene lists Zhang et al., 2013
Marker14750 chr6 8,846,694 8,847,031 + TGCAAGTCTCCTTAGAAAACTTCAATGCCT CTATTCTAACAGCTTCAATGCAGAAGCCCT Gene lists Zhang et al., 2013
Marker14771 chr6 16,777,098 16,777,423 + ATCTGAAGCCATTGGCGGTAAACATTTACT TCAAACTGGGGATTCCTGCCAGTTCAGCCA Gene lists Zhang et al., 2013
Marker15416 chr6 16,885,771 16,886,114 - TTTCTGCATAGTATCATAATTGTTCAAGAA GACCCACCTAAACAAGTAGATGCACAACTA Gene lists Zhang et al., 2013
Marker1546 chr6 16,521,794 16,522,146 + AGGTGCTGAAGTCACATAGCGGGAAGTAGC TTCTCCCATTCCACTGTCATGCTTATGATC Gene lists Zhang et al., 2013
Marker15521 chr6 16,724,219 16,724,532 - CTAAACTCACTTTCTTGGTGAATCCTTTAT GTGGTTTAGTTACCTTGTACAATAAGCTGA Gene lists Zhang et al., 2013
Marker15613 chr6 17,102,547 17,102,872 - GCATCATTTGGAGAAGTATAAGTTTCTGCA CCCCAAGTTGGCAACCGACGATTATTATGT Gene lists Zhang et al., 2013
Marker1585 chr6 16,674,705 16,675,057 - CATCGTCTGTTCATTCAAAGTTACATTTCA GATGGTCAGGAAGAAACGAAACAATGTTAC Gene lists Zhang et al., 2013
Marker16438 chr6 18,030,093 18,030,429 - TCTATTCAAGCTTTTCTCATTTTTTATTTC TTTATGTCTTATCATCCTTCGACATGGTTG Gene lists Zhang et al., 2013
Marker17222 chr6 18,182,832 18,183,186 - ACCAAATAAATGCATTCTATCTTATGCACA AGATAGGACGAATTTCAAAATTTTGGGTTC Gene lists Zhang et al., 2013
Marker17490 chr6 16,852,581 16,852,925 - TAGAGAAGAGGTAGTTTTAGTTACAAAGAG AGTTCAGAACCAAAAATGTCAAGGGCATGC Gene lists Zhang et al., 2013
Marker18557 chr6 23,801,843 23,802,168 + TCAAAGCCCAACAGGGATGGCAATCAGACT GAAAAAACACCATCAAATTCTTTATGACTC Gene lists Zhang et al., 2013
Marker18586 chr6 16,851,401 16,851,712 - AAGGAGCAAAAAGAATTGAGGTATTGGTGT TTAGTTGATACAGCAATGTTTATACTAATA Gene lists Zhang et al., 2013
Marker19249 chr6 16,669,633 16,670,010 - GCAGCCACAAGTGGAAGAATCCAAAGGAAC AATAAGATGAACACAGATTTGGAAATTGGG Gene lists Zhang et al., 2013
Marker19645 chr6 16,659,181 16,659,495 + GTGTCAGTTTTGTGCATTTGAAAGGTGAAA TTTCTTACATCAAACGACTCCTCTATTGAA Gene lists Zhang et al., 2013
Marker19647 chr6 16,398,783 16,399,147 - GGAAGCTGGAGATCCAATTACGTGTCCTAC CGGATTATATTCGATTTTACACTTTTGTGG Gene lists Zhang et al., 2013
Marker19968 chr6 4,380,784 4,381,151 - ATAAGCCAACCTCTTCAGGGGCCACGCCCG AGGGCGCTCAGCTTGACCCGAGGGAAAACA Gene lists Zhang et al., 2013
Marker20017 chr6 8,130,705 8,131,049 - AACAAATAAACCTAGTCAAAGTCAAAATGA TATGTGATGTGAATGTTGTCCAATCTCCTC Gene lists Zhang et al., 2013
Marker20471 chr6 16,548,930 16,549,316 + TTCAGCTGAACAATCAAAATATAAATGTTG TGAGATGGAAAAAGTTCTATCAGCAACCGC Gene lists Zhang et al., 2013
Marker20703 chr6 16,542,448 16,542,799 - ATGTTTCTTGCCTTTGTTTCTCTAGCAGAC CATCTCATCTGCTTCAAAAGACTTTTGTGT Gene lists Zhang et al., 2013
Marker20767 chr6 21,604,166 21,604,528 + TATTTTTGATGGTTACTAATGTCTCACAGT AACACGACTATAGGGGTTGCAGTGGAATAT Gene lists Zhang et al., 2013
Marker21575 chr6 2,822,502 2,822,873 + AGCCAACAAGACGTTCGACCCAAAAGGCCC GGACGACTCCTTCACTCTCTAAGCTATGTT Gene lists Zhang et al., 2013
Marker21727 chr6 16,670,656 16,670,982 - CAATGCATATAATAGAGGGGGTCAAACAGT TCTAGCTGTGACCGAAGTACTACGACGACA Gene lists Zhang et al., 2013
Marker22008 chr6 20,065,469 20,065,771 - ATGTATATTCATAGGTTATGTGCCTAGTCA TCTCATAGACACATAAAGCCCCCTGCCTGG Gene lists Zhang et al., 2013
Marker22221 chr6 17,142,546 17,142,913 - AAGACAACATTTGTAGAGATATTTGCATTC ACAATGAAGACCAGCCCACCAACAGTAAAG Gene lists Zhang et al., 2013
Marker22283 chr6 18,229,040 18,229,420 - CAACAACATAATCCCGTTCCTTACACAGGT CCTACCTTTTCATAATTTTCTAGTCGGACT Gene lists Zhang et al., 2013
Marker22433 chr6 21,499,344 21,499,718 + TCTTCAACAATGGCTTCCCAATGAATTGGG ATTATTGTTGTAAATCTTGGCTTGTATAAT Gene lists Zhang et al., 2013
Marker23123 chr6 21,529,247 21,529,579 + CCTTCTGTCCTTTCACTAGCACCGTTGTTT TCCTGAAAAGTAAGGGCCTATGTCTGTGTT Gene lists Zhang et al., 2013
Marker23499 chr6 14,607,441 14,607,817 + GAAAAATCTTCAAATCGTATACTTCCTCCG ACCATAGAAAATGATGGAAAGTGAACAAAA Gene lists Zhang et al., 2013
Marker23831 chr6 18,477,899 18,478,223 + TTCCAAAGTAGTGCCGGCAAGCGAGGTAGC ATTCTCCTCGAATTGCTGGGTTCTGCTGCA Gene lists Zhang et al., 2013
Marker24047 chr6 18,178,715 18,179,047 - AATAAGTTTCAATAATCCATTATAATAAAG AATGAGGCAAATTGTCTCAAGTGACATAGC Gene lists Zhang et al., 2013
Marker24132 chr6 14,414,594 14,414,954 - AAGACATGGACAGAAAACATTAGAAATTCA TTATAGATGGTTTTCTCGTGATCAAAGCAA Gene lists Zhang et al., 2013
Marker24161 chr6 14,095,509 14,095,899 + AAAAAGGGTCGTTGGCCTCGACGCTGGCTC AGAGGACACGATACTGAAGATTGCTTCCAG Gene lists Zhang et al., 2013
Marker24619 chr6 8,750,382 8,750,700 + GTCCCCGACTCCGATAGTACGGAGTAATCC CTAAGTCGAGGAATTTGGCGTAATGCAATC Gene lists Zhang et al., 2013
Marker24908 chr6 18,243,878 18,244,240 - TAACTTACAGATGTCTATTTTAGATCCAAT TCACGCTTGGTTACATTATCGTATATTATT Gene lists Zhang et al., 2013
Marker25076 chr6 16,873,005 16,873,374 - ATTTACCGTTTTGATTTTTCTGCTTTGCTT CAGCCTATATTTGGAGCCCAAAACCTTATC Gene lists Zhang et al., 2013
Marker25415 chr6 2,869,616 2,869,933 + TAAGATCGTGAACGACCAGTTTATTACGTG TTGTAGGGATGAGTAGCCAAAATGAAGAAG Gene lists Zhang et al., 2013
Marker25470 chr6 15,974,406 15,974,738 + ACGAACCAACGTGGAGGAAAAAGAACAAAT GAATAGTAAATGAACTAATTCGAATCTCAA Gene lists Zhang et al., 2013
Marker26125 chr6 4,888,840 4,889,187 - ATAGACTGATGAACATATTTATACATTTGA GTGAGTTTAGCTTGTACTAGCTGGAATTTT Gene lists Zhang et al., 2013
Marker26361 chr6 15,954,160 15,954,481 - TATCATCAAATTCAGTGAAACTTATTTATT ATCCGTGCCTTGTCAGATTCATTATCCCAA Gene lists Zhang et al., 2013
Marker26374 chr6 15,774,133 15,774,396 - TGGGGTCCACGTGCTGTTTGAAAAATTATA TCAAAATAATCAGTTGTCGTAACTTCCCTG Gene lists Zhang et al., 2013
Marker26452 chr6 18,122,823 18,123,210 - ATCCCTTGTTCTCATTATTCTTCAATTTCA GCTCTTCCCTTCCCATACAGGATGCCAAAA Gene lists Zhang et al., 2013
Marker26782 chr6 16,687,186 16,687,556 - ACCCATCCTTTCCTAGTCTGCTTACAAGAA CAACAAATACAAACTCAAAAAGATATACTT Gene lists Zhang et al., 2013
Marker27020 chr6 17,341,136 17,341,510 - AAAGTATAAATGGGTAAATTGCTATATTTT TCAAAAAGGGCATCAAACATGAGACTGACA Gene lists Zhang et al., 2013
Marker27286 chr6 14,569,609 14,569,916 + CTCCTGGAGGGAAAGATATGATTATGGTAT GTAATAAAACAAATGGTTGGTTATATATGA Gene lists Zhang et al., 2013
Marker27365 chr6 18,216,625 18,217,004 - CCATATTGTGAAAGAGGGGACGAAGGCAAT TCCTGGCGTTTCATCTCTGCCAACAAACAT Gene lists Zhang et al., 2013
Marker27741 chr6 14,613,575 14,613,904 + AATACCTGTATGGCCAACTCCCTTGTTGGA TTCCAAATAATTTGGATACCCTTCAAAGAA Gene lists Zhang et al., 2013
Marker27993 chr6 16,679,963 16,680,289 - GAGTGGAATGTATAGGAGGACACAGAGAGA AAATAATATTACAAATTGATAAATTATTTT Gene lists Zhang et al., 2013
Marker28281 chr6 24,743,601 24,743,908 + CATCCACGTTGCCGAAATCGGGGAGGGCCC GGTATTTCTGCTTGTTTCGCCCCGATAGAA Gene lists Zhang et al., 2013
Marker28387 chr6 14,157,440 14,157,789 + TGCAGCAGTAATATTGTATGCAGGAAGAGA GTTAGGTGGCAAGCCCCTTTCAGAACTCCA Gene lists Zhang et al., 2013
Marker28747 chr6 16,939,469 16,939,797 - GTCAAAATGTAATATTGAGTTGGGCTCCAC AAATGGTGTATGCTAGTTCGAAGGATAGGT Gene lists Zhang et al., 2013
Marker2992 chr6 15,164,097 15,164,435 + CAATGGTTGGGTTCGTTTTTAGCAGTTGAG TATATTATCAAATACTATGTTACAAGAACT Gene lists Zhang et al., 2013
Marker30287 chr6 2,733,310 2,733,629 + CTTTGATGGCGCTCTCCTAGATGGGGGTTT CACGTCATTTTGTTTATGTCATGCGTAGTC Gene lists Zhang et al., 2013
Marker32061 chr6 6,105,027 6,105,412 - CTTGTTGTCATCACTGAATATTTTTAGGTT GTGCTAGACAATTTGATGCAGGTAATTTGT Gene lists Zhang et al., 2013
Marker32087 chr6 139,132 139,516 - TGGGATCATACCAGCGTATAAAGCAAAGCT TTGGAAGGAGAATCCAGTAAGCTTGAAGAC Gene lists Zhang et al., 2013
Marker32728 chr6 16,640,572 16,640,908 - TTATAATTATCATGAAGAACCAATCAAATT ATCTGATTCAAGAGTAAATTTTAGTGTAAG Gene lists Zhang et al., 2013
Marker33090 chr6 18,046,692 18,047,042 - GTTGCAGAGAACAACAGAAATGAACATGTA AAAGAGAAACGCCCTCAAGACTCAAGATTC Gene lists Zhang et al., 2013
Marker33388 chr6 18,263,017 18,263,351 - AGGCTTTTGTTATGATTCATTCACTTTTGT AAAAATATCAAAATGTCAAAATTACAAGTA Gene lists Zhang et al., 2013
Marker33664 chr6 21,475,600 21,475,929 - CAGTACATCAAAACATTTTTCTAGTTGATT TATGAGTTGGCATTTTCTAAAACTGCAATA Gene lists Zhang et al., 2013
Marker33825 chr6 8,842,856 8,843,176 - GTTCCCGGCTCCGCTAGTACGGAGTAATCG GAGCAATTTGGCATAACATGATCTCAAATA Gene lists Zhang et al., 2013
Marker34442 chr6 16,889,626 16,889,992 + AGATGTCTTACTCTTGTGAATAAAACTGAA TCATTGTGCTACAACAGTGCAACTCAAATC Gene lists Zhang et al., 2013
Marker34764 chr6 16,729,988 16,730,302 + CTATTTATTTCCCTTATCTTTGGGTCAGGT AAAAATTCAAGCAACCATCTATAGTAAAAC Gene lists Zhang et al., 2013
Marker34868 chr6 17,727,913 17,728,242 - GGGAAGAAATTAGAGTGATGAGAGAGAGGC ATATCATTTTTGGTGTACAATTCAAATTCT Gene lists Zhang et al., 2013
Marker34896 chr6 16,729,431 16,729,762 + CTAATGAAGTATAAAACATTTATTCTTACA TCGATCAAAGATCACCAGATAAGCATATAT Gene lists Zhang et al., 2013
Marker35193 chr6 17,138,332 17,138,621 - AATCAAGCATTGCGAATAGAAATCCATAGT ACCCTATAAAACAAACATAGAAGGGAAACA Gene lists Zhang et al., 2013
Marker35757 chr6 18,251,055 18,251,405 - ACAAGGTAAGCCTCTACAATTGACGCCTCC ATAGGATCGAGAATAGAAGGCTAACCTCGG Gene lists Zhang et al., 2013
Marker36356 chr6 14,517,004 14,517,346 - ATACATTGCAACATGATAAAATTCAACAAC TTTATTTACTGTAATACCGATAGACCCAAT Gene lists Zhang et al., 2013
Marker37401 chr6 18,102,321 18,102,621 - ATGGTCTCCACCACCAAAGGGCTTTTTCAT ATCAGGCATACTTAGCGTAGTGGACTAAAA Gene lists Zhang et al., 2013
Marker37484 chr6 16,853,383 16,853,715 - ATTATTGAAAGCACGACTTTTCCACGATAC ATTTTTACGTCAACACCCATAACAGAGTTA Gene lists Zhang et al., 2013
Marker37604 chr6 16,303,504 16,303,828 + CTACTTGTCATGCATTATTTGATGTCATCA CAAACAATTGGATTTCACAAATAATAGGAA Gene lists Zhang et al., 2013
Marker38378 chr6 22,861,029 22,861,361 + TTGATCTCCTTTACTAAATCCCTGATCACA GGATACGAGCAACAGAAAATTGATTATGCA Gene lists Zhang et al., 2013
Marker38422 chr6 14,380,160 14,380,484 - AAAATTTTGCCAAATATGAAGACCTTTGAA CCTTACTTTCAGTCTCATGTTGTACTTGTA Gene lists Zhang et al., 2013
Marker39107 chr6 7,095,190 7,095,482 - CCGTATCAGATTGCAGATGCATCAACAATA TTGTATGGTGGCAATTCTACATCTCTTCGA Gene lists Zhang et al., 2013
Marker39456 chr6 16,016,648 16,016,936 - GGAGTAGTCGCATTTTTCACATATATATAG GCCGCCATATCAACCTCCTCTACACACATT Gene lists Zhang et al., 2013
Marker3959 chr6 14,589,124 14,589,468 + ACATAACAAACATAAAATGGACCAGCAGAA GAAGATAGGATTTACTATATGGGGGCAAGC Gene lists Zhang et al., 2013
Marker40154 chr6 14,645,624 14,645,945 - AAAAACATGAATATGACCAAATAGGAGGAA GCATGTCTACATCAATAATAATATATGTAA Gene lists Zhang et al., 2013
Marker40714 chr6 16,767,369 16,767,705 + AAAAGGCACTAAACAGTATACTAAATTCTT CATAGTTCTGCACTACACTTCCCAATGAAT Gene lists Zhang et al., 2013
Marker41159 chr6 16,828,395 16,828,697 - CTTATGTGAATATTATTATGAATGTACCCG TCTTATGTTTCGTACTGAAACTATCAGAGC Gene lists Zhang et al., 2013
Marker41649 chr6 14,616,910 14,617,206 + GTTGATTTTCTGAAGTACAGTTCACCAAAT AGGAATTGGAGCATCAACACTAACACCCCT Gene lists Zhang et al., 2013
Marker41905 chr6 16,739,447 16,739,838 + TTACTCAAATTGGGGAAATATGCGAGCACA GTTTCGGTTATAATGGTGAATTTGATTGAA Gene lists Zhang et al., 2013
Marker42461 chr6 14,463,393 14,463,697 + ATCGAAATTCAATTCCATAAATTCAAAATT TGTTGTAATGGTCTTTATTAGACATTGATA Gene lists Zhang et al., 2013
Marker42954 chr6 14,471,906 14,472,281 - GATCAGGCAAGCTGGAGGTAGGAATAGAGA CAGCAAAATCCACAGTTAGCATTTCAATAA Gene lists Zhang et al., 2013
Marker43289 chr6 16,999,504 16,999,799 + AATGTTGGTGGCCTCCACTCATTATCTCCA TCATTATCCTAGATCTCCGAGTATCGTTCT Gene lists Zhang et al., 2013
Marker43326 chr6 15,784,479 15,784,790 - CAGAACTCTGTGCGAATAAGATGTAAAACC TAGTTGTGTGGTTGGCCCAAGTAGCATTAT Gene lists Zhang et al., 2013
Marker4362 chr6 19,399,822 19,400,182 - GAGGGCGAGGAGAAGTTCAGAATTTGGGTT CTCCATGTAAGACACTAGATGGCATTTGAT Gene lists Zhang et al., 2013
Marker43898 chr6 16,697,780 16,698,155 + CCAGGGGCCAAATAAAAATATAACCACCAG ACTTTAGGCATATGTATAAAAGCAAAATTT Gene lists Zhang et al., 2013
Marker44803 chr6 15,721,981 15,722,277 + AAAAAATAACCTATAAAAAATAGGGATCAT ATCTTTTATTTACTAAACACTGTTTAGAGA Gene lists Zhang et al., 2013
Marker44948 chr6 15,079,634 15,079,971 + CTAAAGTTCGTCTGAGCTCCATTTGATTAT TTTGATTGATTATTACATCATTCATTATAT Gene lists Zhang et al., 2013
Marker45675 chr6 15,054,988 15,055,355 - CTCCTCAATTTGTAACTCCATCGTTTCATA CATTCTACTCTATCATAGATTTTGCTCATG Gene lists Zhang et al., 2013
Marker47672 chr6 1,743,041 1,743,358 - AATCTGCTAATACACTGATGTATGTGTAAG CAGTGATGTAATATTACATCAAGTATTTAT Gene lists Zhang et al., 2013
Marker47706 chr6 14,366,432 14,366,793 - ACTTACACCCCTTCCGAGACTTCTCAACTT TCCACTACATGAAGTACTTGCACAACACAT Gene lists Zhang et al., 2013
Marker47814 chr6 14,356,509 14,356,800 - TCCCAGATGATGGATAATAAATCAATTGCT AGTGCACAATCCATCATAACAGATGTAAAT Gene lists Zhang et al., 2013
Marker48880 chr6 16,311,750 16,312,120 - AGGACTAAAATTATAATTTTCCATCAAAAT GTCCGATGGTCTAGAATTATTTCACAAACA Gene lists Zhang et al., 2013
Marker49260 chr6 15,134,989 15,135,338 + TTAGACCCAACATACTTCCGAAATAAAATA TCAAAACATAGTTCAAAACTATAGATTAGG Gene lists Zhang et al., 2013
Marker49384 chr6 16,925,311 16,925,646 - AAGTCTAAGGTTTGTGTTGTGGGCTTTTGT ATGACTAAAAATCATGATAAATGACTACTA Gene lists Zhang et al., 2013
Marker49525 chr6 14,622,847 14,623,144 - GAGTTATTGTGTGCTTGTGTATTTATGTCA TGAAAAAAGGTGTTGACGCTGTTCACAAAA Gene lists Zhang et al., 2013
Marker4961 chr6 17,030,580 17,030,943 + GCAACCATAAAAAACACTCGAGTTGGAGAA CTTCCAATATCAGTTAGAAAGAACGATGTT Gene lists Zhang et al., 2013
Marker49680 chr6 14,900,846 14,901,136 + AAATCTCGTTTGATAAAATTCTCATTTTTC CATGACGTCATGTTCGACCTTTTCTTTAGA Gene lists Zhang et al., 2013
Marker49746 chr6 16,546,714 16,547,027 - CCACCAGTTCAGTTGCATGATCCAAATTTA AGGTAATTCATAGATTGGAATGTGATCGCT Gene lists Zhang et al., 2013
Marker49760 chr6 15,910,728 15,911,044 - TGTTGACTGCGAATGATTTATTGCTTTCTT TTATCTTGATCTAGACGACAATGGCACTGA Gene lists Zhang et al., 2013
Marker50200 chr6 16,671,262 16,671,634 - CCTGCAAGTAGAAAGAATTTCATTAGTGAT GGAATCTATAATTTAGATGAACGTACAAAA Gene lists Zhang et al., 2013
Marker51988 chr6 2,322,319 2,322,655 + GCAAATTCAGTAAATTTTCACTAATTAGGG GGGGAATTATGGTGTGTGGTCCAAGTACAA Gene lists Zhang et al., 2013
Marker5246 chr6 4,378,858 4,379,218 - AACCAAACACATTGGGACAGAAAGAACACA ACAAACAAGAAAACAGGGGAGGGGAAGGAA Gene lists Zhang et al., 2013
Marker52994 chr6 11,554,461 11,554,732 - ATTGATTGTATTCCATACGTGTTGCCGGTT TGTTGTATAGAGAGAACGTAGACGTGGAGA Gene lists Zhang et al., 2013
Marker53520 chr6 15,788,427 15,788,710 + CTTTTCTTCCCAGTAGAGGTCATGAGGAAC TTTTCCTTTTCCTGTTTCTTTTACTATCAA Gene lists Zhang et al., 2013
Marker55348 chr6 14,518,477 14,518,768 - AACTATGAATGAAATTAGGATACTGTAATT GTATCTATGTAAGTATCGGTGTTTAGGTTC Gene lists Zhang et al., 2013
Marker55362 chr6 21,598,437 21,598,720 + TCAATGTTTTGAAACCCAAAACATTCATCA GTATATCAGCAGTTGGATCCTCAAACCCTT Gene lists Zhang et al., 2013
Marker55863 chr6 16,404,201 16,404,488 + TCTGTTTTCAACTCAAATGTAAGTAAACTA TAAGATAAGTTTCTTTGCAATTTTGGTCCT Gene lists Zhang et al., 2013
Marker57188 chr6 14,505,852 14,506,130 - TATCAACAAATTCAGTGAATCTTAGCTAAC AGTTTTCTACGACTATAATCAACAAAGTAC Gene lists Zhang et al., 2013
Marker57405 chr6 16,850,239 16,850,551 + TGAGATTCAAGTGATTCCTCTGTTTCTGTT CAAACTTATTTTTTCTGCAAATCATACTAA Gene lists Zhang et al., 2013
Marker5989 chr6 14,608,139 14,608,464 + CTGTTTCCCCAGTGATGCAGGAAGTGTCAG CTTCAGAGTTGTCAGTTGTGAGTCACATGC Gene lists Zhang et al., 2013
Marker60184 chr6 17,132,609 17,132,902 + AGCAGAAGAGCTCATCCATTGAAGGCATAG ACCAAAGAAATATTAGCAGTCTGCTTTCAT Gene lists Zhang et al., 2013
Marker6377 chr6 18,069,307 18,069,665 - ATACATTCACTTTGTAAATCTACTGCAATA TAGTGAAGCTATACAGACTTGTAACCCACA Gene lists Zhang et al., 2013
Marker6490 chr6 18,032,225 18,032,584 - GCCATTTTACTGAACATGATTAGGCAATGA CATGATTTATGAACTAAAACTGCACTTTTT Gene lists Zhang et al., 2013
Marker7826 chr6 7,094,492 7,094,856 - AGATGTAGACATGTTGTAGTACTAGAGAGC GTAGAGACCCCTACCCTACCCTAGACCCCA Gene lists Zhang et al., 2013
Marker8836 chr6 19,441,839 19,442,193 + TCCAAACCATATGTTACTGTGTTATAGATC CAAATTCAGTTCTATTTCCTTCATGTGATG Gene lists Zhang et al., 2013
Marker9510 chr6 16,823,357 16,823,706 + GTGTGAGAATGGCTTCTGAAATAATCACCC TTCATCTAAATATACATCACAGGTCAAGCA Gene lists Zhang et al., 2013
Marker9644 chr6 16,408,378 16,408,750 + CTGCAAGACAACAATCTTATCCTAAGACAT TTACCACATATATCTGGCAATAATGCCATC Gene lists Zhang et al., 2013
Marker12856 chr7 11,356,684 11,357,030 - CAAGGAGCCTTGAAATCAAAGCAAAGTCGG GGTAGATTATTGCTTATTTGTATTTACCAC Gene lists Zhang et al., 2013
Marker16378 chr7 13,591,305 13,591,671 - CTCTGCAAGGTAAGAATAGCAGACGTAATT GCATGCGACAAATTGCTCACTTTCACCGTT Gene lists Zhang et al., 2013
Marker17630 chr7 9,820,841 9,821,196 - CAAGACGTACCTAGTATTGTTATTTTGGTG GATAGATAATTTTTCATGCTGTTCACACAA Gene lists Zhang et al., 2013
Marker18367 chr7 11,327,846 11,328,188 + ACAAGAATAGAAAACTTTATTCTATAGAAA CATCCTAACCCTCAATCTCTCACCCAAAAA Gene lists Zhang et al., 2013
Marker18604 chr7 15,931,315 15,931,626 + AATTATGTGATTTGGTATGTTTGGGGTTGA ATATAGCAAATGGACAAACTTTGCAGGGTG Gene lists Zhang et al., 2013
Marker23860 chr7 15,878,871 15,879,184 - ACAGAAACCTCTTTAGATGTAAATATATAT GTTGTGACATTTATGGAGTCAAACAGTTCC Gene lists Zhang et al., 2013
Marker2555 chr7 11,338,839 11,339,180 + GAGAGAGCACAACCCTGTCATGGGAATCAG CACGTTCCATCTCCTTATCTTGAATACGTT Gene lists Zhang et al., 2013
Marker26437 chr7 10,528,820 10,529,133 - CTACACTGAGTAATTTTCTGCATTCTCCCA TTCAATCCATCCACCAATGCTAAGATTAGT Gene lists Zhang et al., 2013
Marker26862 chr7 15,894,401 15,894,746 - AATTATCAATTTTCAGTTGAAAGATCCAAA ACAGGCAGAATTGTGATCGGCGCTGTTGGA Gene lists Zhang et al., 2013
Marker27897 chr7 16,610,452 16,610,749 - TCATGTATGCAACGCATACTTTTTGAGCGT AAACCTCTCACGAAAATAATGAATAATACG Gene lists Zhang et al., 2013
Marker30267 chr7 15,873,406 15,873,728 - TGTCCCTATGGATTATGGGGGGGACTGCAT TTCTTTGTTTTTGGGCCCGTCTCGCTTCTC Gene lists Zhang et al., 2013
Marker30663 chr7 13,395,310 13,395,686 + TTTCGTGCTTTCAGAAATCAGAGATTGTAA AGGAAGAGGAAGAGGAAGAAAGTGAAGAAT Gene lists Zhang et al., 2013
Marker34025 chr7 15,927,721 15,928,049 - GTTAGGCCCATGTGCCCTTTTATCTCTCTT AGACTGATTTGTAAAAAATACATTAGTATT Gene lists Zhang et al., 2013
Marker34158 chr7 10,249,471 10,249,802 + AACTTTCACTTGACACCTTTAGTCTGGTTG TATTGTTAGTCAATTGCTATATAGTTTTAG Gene lists Zhang et al., 2013
Marker35721 chr7 11,579,600 11,579,987 - TGTTGCATGCAATGGTTTACCAAAAAATTT GGAGACGACACGCACGTGGCATGAGCTTCA Gene lists Zhang et al., 2013
Marker37704 chr7 10,508,314 10,508,646 - ATTGCAACTGACTTTGTACTGTTGCAATAT TTCTTTTGAAATGATGATTGGGTATATAAA Gene lists Zhang et al., 2013
Marker42605 chr7 11,875,832 11,876,176 - CTTACATATTGTCCATAATGTGAAAATAAA GACGATCACCGCACGCTTCCTTTGATAATA Gene lists Zhang et al., 2013
Marker44347 chr7 10,485,116 10,485,534 - TGATGGTGAAGTGCCAAATAGAGCCAACGA TTTGTGGGTAATGTGCCTCTACAATCGGGT Gene lists Zhang et al., 2013
Marker46568 chr7 14,250,167 14,250,499 + AATAAACTATGAATGGTCCTTATAAAATTA CAAATGAAAAGTGCTAAAATTACCAAAAAT Gene lists Zhang et al., 2013
Marker46760 chr7 10,530,778 10,531,104 - ACAAAAACACTACAATCTTTATAGGAAGAC TCTGCGAGATTAGAAAATAACCAAGTAATA Gene lists Zhang et al., 2013
Marker5285 chr7 15,905,403 15,905,740 + TAATTGAGCCATTGATATCATCACTCAATT TAAATTCCATCACCAACAACTTGGAGGTAC Gene lists Zhang et al., 2013
Marker12386 chr8 21,919,151 21,919,504 + CTCAAAAGTTGATCTTATTCATCTCTTCTT GTTTCTTCCTCCATTTCTGATTTTCATGCA Gene lists Zhang et al., 2013
Marker13244 chr8 6,210,756 6,211,135 - GGGCGATACACCCCAATAAAAAAAAATGAC CCGTAGAGGGAAGATACGGAATTTGCCAAT Gene lists Zhang et al., 2013
Marker13629 chr8 18,968,314 18,968,627 - CAAATGGAGTAGAGAGAAAAATGTGAAGGA GGCAACGGGCAAATCTCACAGTACACAAAA Gene lists Zhang et al., 2013
Marker14169 chr8 7,071,251 7,071,596 + TTTTGGCAATATTAGTTTTGATCCATTATC AGGGCGTAGAAGATACTAAAAAACAGAGAC Gene lists Zhang et al., 2013
Marker15173 chr8 552,652 553,022 + AAAAAGAAAATCTTGAGCACAATATCATGT AGATGCATAACAAAATTGCTGCTCCTGGTA Gene lists Zhang et al., 2013
Marker15311 chr8 12,802,550 12,802,907 - TCTCTATGGTGTGAATCGCAGCAGTAAAAC TCTTACCAAATTGAAGTCACCATGTCCAAA Gene lists Zhang et al., 2013
Marker16478 chr8 21,627,419 21,627,723 + TCCAGAAATCAAGATCTATTGCTAATTATG TTGTGTGAAATTGGATTGTTATTTTCCAAG Gene lists Zhang et al., 2013
Marker1798 chr8 7,135,941 7,136,292 - GTTGAACTAACTCGCAGGAATCATCATATG ATTGGTCGAATAAGTTATGGATCAATAGAG Gene lists Zhang et al., 2013
Marker18107 chr8 21,618,362 21,618,694 - TAGAAATCTTGCAACTAAAATATTCAAGCA TGCCTGTGATTTCCAAAGATGATGTTATAG Gene lists Zhang et al., 2013
Marker18953 chr8 16,856,957 16,857,263 - CGTATAATTACACCAAATCTCAAAGGGAGG TCAGACAGAATCGTCTATACAGTCGTCCCT Gene lists Zhang et al., 2013
Marker2001 chr8 7,138,559 7,138,921 + GTACGAAGCCATACTTTTTCTCAAAACAAA ATGCCAAGTATGTTTCTTAGCCACGTCAGA Gene lists Zhang et al., 2013
Marker20191 chr8 12,763,721 12,764,049 - AATGTTCCAAATTTTGACAAAGAATGTGTG ATGTCAAGATGCAATAGAGGAAACGGGATG Gene lists Zhang et al., 2013
Marker21160 chr8 22,665,548 22,665,862 - ACCTTTCGTCATATAACTGCCAGTGAAATG AAAAACTAATCCTGGGGTTCATGGGAATAA Gene lists Zhang et al., 2013
Marker22231 chr8 21,693,203 21,693,576 - AATGCCATGATAATCTGTTGCTGGAGGATG GGGTGAAGAAAATAGATGCAGTGCAACAGA Gene lists Zhang et al., 2013
Marker2243 chr8 7,045,147 7,045,848 + CCTAAAGCCAACCACCCATTGACCTCAAAC ACCACCGTTCAGCTTGAATACAAAAGCCGA Gene lists Zhang et al., 2013
Marker22551 chr8 6,275,974 6,276,362 + ACAAATCGCATCCTAGGACTTGGATAGTAG CGTTCATTTTAGATTTCGTCTCTGCTACTA Gene lists Zhang et al., 2013
Marker22682 chr8 13,900,224 13,900,596 + CGAAAAATTTAGAATGAGCACATAACTTCA ATACGATATTGATATGACAACACATAAAAT Gene lists Zhang et al., 2013
Marker22687 chr8 7,100,069 7,100,440 + ATTATATTAGCACAAGTTTTATCTTGTAAT AGTTATGGCCAATAAAATCAATTTCCCCAA Gene lists Zhang et al., 2013
Marker23177 chr8 1,733,802 1,734,160 - ATCATCACCACTTGTTGGGGAACAGTGCTA TGGAATACTAAAGAAAACAGGGAGACTATT Gene lists Zhang et al., 2013
Marker23307 chr8 22,662,572 22,662,919 + AAATTGTTGCTTTGGGAGGAGATCGATTTA TCTGATTCGATTATAATTAGTGATTTTGGT Gene lists Zhang et al., 2013
Marker2401 chr8 22,663,338 22,663,696 + TCAGCATTATCCATTTCTCTCCATGACTTC TTTACGTATTATTTTGTTCATTCCGAGCCG Gene lists Zhang et al., 2013
Marker25008 chr8 18,941,151 18,941,481 + CATGGCCGAAGATCAAACGACCAAAGTAGA GGAAGAACCCTAGCAGCAGAGCTCTCCGCA Gene lists Zhang et al., 2013
Marker25332 chr8 6,275,160 6,275,456 - ATAGGTACAGAAGAAAAACGAAGAAGCAGA TCCCATTCAATTAGGTAAACCCTAACGACG Gene lists Zhang et al., 2013
Marker25768 chr8 565,237 565,548 - AGACAAATTAGACTTCTGAAACTGTTTCCT CTTCCATTACATGTACTCCAGTTATTCCAC Gene lists Zhang et al., 2013
Marker26677 chr8 18,997,496 18,997,797 - GTTGTCTTCCCAAACACTTGAGAAAATTGC TTTGTTGCGACAACCATGTCTTGCAAATCA Gene lists Zhang et al., 2013
Marker26923 chr8 7,139,360 7,139,728 + ACGTTGGTGAGAAGGGTAAAAGATGAAAAT TCTTATTTTTTATTTCCGCTTCTTCTTCTC Gene lists Zhang et al., 2013
Marker28308 chr8 1,725,083 1,725,450 + TTTCTTATAATAAAGACCTATACGAAGAGT ATGTTGCTAGTAAAAGTAATATAACATGTC Gene lists Zhang et al., 2013
Marker29020 chr8 1,385,959 1,386,312 + ATTCAGCAGGCCTTGAATTTATTTTATAAA CACTTGGTAAGATTTTGATATTGATCTCTT Gene lists Zhang et al., 2013
Marker29780 chr8 18,969,524 18,969,898 - AGAAATCATAGGACGAGTACAATGTAACTT CATGTCTGCTCCATCAACAACATTGAAAAA Gene lists Zhang et al., 2013
Marker30234 chr8 18,979,308 18,979,609 - ATAAAAGAATAATTGGGGGTGGAGAGACAA CATCACGCTTGCCCCACTACCCCCCCTTTT Gene lists Zhang et al., 2013
Marker3025 chr8 1,737,299 1,737,617 - ACGGGTGGTCCTACCATTTTGACCATTGTG GAGTCACAAGTCACTGAAGTTTGGTTGGAC Gene lists Zhang et al., 2013
Marker30368 chr8 21,704,484 21,704,873 - TCAGATGGGGAATCCAGGTCATCGCATGTT GTTGCTTTCCTTTTCTCCGTTTTCTTTCTT Gene lists Zhang et al., 2013
Marker32637 chr8 7,096,741 7,097,053 + TAAGCACATAGCCAAAAGTATCAGCTTCTG ACATAATATCTGATGTTATCGTGTATTTTC Gene lists Zhang et al., 2013
Marker3342 chr8 12,806,113 12,806,436 + TGACGATCCGACAGTTATTCGCTTGAATAA ATCGTTCGAAATAAATCATTTCATTCATCT Gene lists Zhang et al., 2013
Marker3373 chr8 553,286 553,666 - TTGCAGGCAACACCAACACTTGCAGCAGCA GACTATAATGGGGAGAAGTTTCGGAATAGG Gene lists Zhang et al., 2013
Marker33803 chr8 1,727,612 1,727,910 + CAATAAGCTTCCGCTTTTGGGGCCGAAAGC TCAGTAAGAGTGAAAAGATTGTAATTGCAA Gene lists Zhang et al., 2013
Marker34299 chr8 18,943,378 18,943,759 - TGTTTGCTTTGCTCTAATTACAAATAAAAA TTATGTTTGGACGTCAATTCTTGATATTGA Gene lists Zhang et al., 2013
Marker34463 chr8 21,157,999 21,158,328 + TAAATGTTCAAAAGATTCCTCTTTTTGCAA AAAAGCAAATCTCATCTCCATACAACCCAA Gene lists Zhang et al., 2013
Marker35490 chr8 7,099,416 7,099,792 - TCTGCCATGTAGTGAAGAATGTTCTTGTTT TAACTAATAGGAGTAGAAAAAGCACAACTA Gene lists Zhang et al., 2013
Marker36799 chr8 18,990,326 18,990,622 - AGCAACTCTATACTCATTCTGAGTCGCTAT AACATCTCTCAAGGGGAGTCAAGTAAATAC Gene lists Zhang et al., 2013
Marker37716 chr8 22,664,462 22,664,844 - GGTGTGATCAGACTGTTTGATTTGTGCTAA TCATGGAAGAAAGTCTCCTTGAAAGTAAAT Gene lists Zhang et al., 2013
Marker3868 chr8 21,668,335 21,668,664 + CAACAGCCATTCTTCCTGTTACCATTGGTA TTATGGTTGTTGCTTGGCGTAATTAGTTTA Gene lists Zhang et al., 2013
Marker40968 chr8 21,638,324 21,638,662 + TATTATAATAAAAGAAATTGGTTGGAAAGA TCAAACTCCAAGGTACGAAGTTATCGATGC Gene lists Zhang et al., 2013
Marker41450 chr8 3,903,142 3,903,515 + TAAAACACGAGTTAGTTGGAAGCAATTGTA AAGGTAAAATGTGGTCAAGACGACGTACCT Gene lists Zhang et al., 2013
Marker4403 chr8 18,938,211 18,938,517 - GTAACTTTCCACTGATAAAGTACGTGACTC TCTGAGGTGAGTATGTTCCTCCCAATGGTA Gene lists Zhang et al., 2013
Marker45794 chr8 18,950,614 18951,003 - CTAGCAAAAGCCTGGGACCAAGAAAGATGA TATAAAGTTCTCAATCAGTACTAATGAGCA Gene lists Zhang et al., 2013
Marker48799 chr8 21,657,843 21,658,222 - GTTTTCCTCAATTTCAACATCCGCTATCAA TTCAAAGCACGTATAAGAGTACTCGAGTTT Gene lists Zhang et al., 2013
Marker49064 chr8 21,126,661 21,126,975 - TCACTAAATGAGTATATTACATTTGTTATG TTAGTTCTGTAATTACTGGAAGTGATATTT Gene lists Zhang et al., 2013
Marker51566 chr8 21,664,264 21,664,555 - TAAATCTGACATTATCTCTGTTCTTGAAAA CCAAACTAACCTCATAAACTAATCACACGA Gene lists Zhang et al., 2013
Marker53716 chr8 1,368,879 1,369,252 - GGAATACATGTATGTAAGAAACAGACAGGG AATGAATATTGGCCATGTTTGGATTCATTT Gene lists Zhang et al., 2013
Marker53737 chr8 502,649 502,928 - GGATAAATGTAACAAATGGATATGGAGGGT GGTCTGAAGTTGGACCTGAGAAGATGAAGG Gene lists Zhang et al., 2013
Marker54439 chr8 12,763,419 12,763,716 - TATTATCCAAGATCTTTTACCTTGTAAACA TATTATTTTCTTCTGTATGTCTAAAGTTAT Gene lists Zhang et al., 2013
Marker55230 chr8 22,639,278 22,639,559 - TCACTTATATAATTTCTGTTCGCCTTGATG ATGAGTTACACTTCAGATAACACCATCAGC Gene lists Zhang et al., 2013
Marker56046 chr8 18,946,008 18,946,324 + TTTGTATTTGCTACAATTTTCTTCTTTTGA TGCTCAATTATTCACTTCATATTGATGTAA Gene lists Zhang et al., 2013
Marker7394 chr8 7,146,527 7,146,881 - ACCAACCAGAAATTCCATCAACTGATCTGT CTGTTTTCTGCGGGTTTTGCACCATCTCCA Gene lists Zhang et al., 2013
Marker7518 chr8 21,649,866 21,650,180 + GAGAAGGAAAAGTGTCGGGCCAATCATCAT TTACTGTTTCACCTCTTAGCTCTTGTTAGT Gene lists Zhang et al., 2013
Marker7661 chr8 21,710,759 21,711,086 - GTTTATGAAGAACATATTTCTTGGATTCAC GTCACTACAATGATCTTGCCTCCCTTTTCT Gene lists Zhang et al., 2013
Marker7697 chr8 21,624,683 21,625,028 + AAGACAGTTGTTTGGGGAAGTCCAAAACAA AGTTTTATCATTGTCTTTCAGTATTATTGG Gene lists Zhang et al., 2013
Marker7703 chr8 21,691,438 21,691,816 + GGAACTCAACGGGTTAGTGTAAAAAAGCTA TTAGTTTATTGTTCAGAAAGTTATTTTGCT Gene lists Zhang et al., 2013
Marker7951 chr8 22,649,629 22,649,957 + AGACGTAAGGGGCAGATAGATCAACATTTT TACAAGAGTCATAAATTACTTCAAGGCTCA Gene lists Zhang et al., 2013
Marker9382 chr8 21,666,106 21,666,470 - ATGTCCTGTCTTCAGAGAAAAACAGAACAA TGGTTCCGCCTGAAATATAAAATGACCAAG Gene lists Zhang et al., 2013
Marker12202 chr9 17,795,548 17,795,862 + TAGAAAAGCTAATAATGGGAGGAGTCACCG ATCAGATAATCATAATAAGCATGACGTCAG Gene lists Zhang et al., 2013
Marker12218 chr9 17,789,274 17,789,605 - ACCGACTGAAAGTGGGACCCCTACTCTCAT GGGAGCAGAAGCCGTGTCTGTGTGGGTACC Gene lists Zhang et al., 2013
Marker14104 chr9 2,462,688 2,462,989 - AAAAATCAGAAATGAAACAACAGGAAAAAT CTATTCCCACTTCTGAAGTGTCCCGAGTGC Gene lists Zhang et al., 2013
Marker15523 chr9 3,550,191 3,550,587 - TTGAAGATGCAAAAGTAGCTAAGAGTACTG AACAAAAGCCACCAGTGGATAGTGTCACCT Gene lists Zhang et al., 2013
Marker15528 chr9 3,723,468 3,723,811 + AGATATCAACTAAAGAAACTTCATTTTACC TATACTGCAAGGAACTTCGAGTTATTCCAA Gene lists Zhang et al., 2013
Marker15542 chr9 17,268,932 17,269,303 - AACAGAAATCTATAAGAAATCATTTATGTA ACGCGACATCAATACAAATATTCCCATGCA Gene lists Zhang et al., 2013
Marker15774 chr9 5,404,738 5,405,101 + CTCAACTAAACCAATTTACCCCCTTCATGC AGCCATCAACTAACCTAATTCCACGACGCC Gene lists Zhang et al., 2013
Marker16464 chr9 3,625,151 3,625,508 + TATTCAGACTCCTTTTCATGAGCATTCAAG TGAAGAGCTGTATGTGCTATGGTCCTGCAA Gene lists Zhang et al., 2013
Marker17246 chr9 3,664,510 3,664,805 - CGCTATACAACATAAGACTGAATGGCAGAA TCTAACACAGAGGCATATGAAACAAGAGAT Gene lists Zhang et al., 2013
Marker19089 chr9 13,543,335 13,543,535 - CAGTTTCCTACATCGACAGATTCTTGTCCG TAAAGATGGAGGCTGATGTGCTCAAATCCC Gene lists Zhang et al., 2013
Marker21309 chr9 20,152,199 20,152,494 + TGACTTGGCCATGGATCTCCCTCCCACAGT ACCACGCAAATATTGTACTGAAAGGGACCC Gene lists Zhang et al., 2013
Marker2139 chr9 3,536,221 3,536,559 + TGAAACAAAGAAGGGCAGGGTTTCATTTAG CTTGTGCCTTGTGAGTAACAGCCATGAGCG Gene lists Zhang et al., 2013
Marker22263 chr9 20,549,241 20,549,631 - GTAACCGCTCCTTTTTACCTGCCAAACCAA TTGTTTGTGGCCCAAGAACACACGGTACCT Gene lists Zhang et al., 2013
Marker23405 chr9 19,652,869 19,653,194 - GCTTTGATTCTCTGTACACATGTATCGCAT ACTTGATGCTCCAAGACTCCAGATAATATG Gene lists Zhang et al., 2013
Marker24039 chr9 17,257,960 17,258,348 - ACGTATATCTTGACCTATGTGTTGATTCCC TGGGCTTGACTTTGTATTTGGACAGTAATG Gene lists Zhang et al., 2013
Marker24169 chr9 3,764,000 3,764,363 + TTTATGCATACAGTGGAGGTCCGACCAAGA CTAAATTGACTAATAAAAAGGAGTAAGGAC Gene lists Zhang et al., 2013
Marker25057 chr9 20,357,975 20,358,322 + GACTGGTGTACATCATATTATCTACTTGAT AAAAACTGACGCGATATGCTTCTAATATCT Gene lists Zhang et al., 2013
Marker25129 chr9 20,295,361 20,295,654 + GGTGTTTGGATGCAGAGGATTAGGGTTGGA AGTACTTCCTAACCCGACCTGTGCGTAAAG Gene lists Zhang et al., 2013
Marker25341 chr9 3,759,975 3,760,361 - CCATGAGGAGATGTTGTACAAATGGGAATT TGTCTTGCCTTTCCATTGTACTTTGCAGAA Gene lists Zhang et al., 2013
Marker26421 chr9 3,486,381 3,486,683 + ATATCGCTCTCCAGCTAATTTATTTTATGT TTTTATCAGCGATACCAAAACACCACCTTG Gene lists Zhang et al., 2013
Marker26981 chr9 1,432,382 1,432,760 - ATCTTCTAGCAACCACTTTCTCTTCAATTC CTATCTCTAAGATAGCCCTGCTCGTTCGTT Gene lists Zhang et al., 2013
Marker28680 chr9 16,756,298 16,756,620 - AGTAACCCCTAAACTCTAAAAGCTTGGACT TACGACACATTTTACCTTCATACTACAAAT Gene lists Zhang et al., 2013
Marker30008 chr9 19,554,930 19,555,243 + CCGTAGAGATGCAAGCTTTTTTCGTGAAGA TCATTAGCAACACAACACTCACAAAAAAAA Gene lists Zhang et al., 2013
Marker30357 chr9 16,768,087 16,768,430 + TAGTCGTAGCAAATTTTGAGCATTGAAGAG ATGCTTTCGAGTAATCTTTTTTATGATTAG Gene lists Zhang et al., 2013
Marker3068 chr9 20,537,451 20,537,799 - ACATGAGCAAATTGCAAACAACAAACATAG CACTCGTGTTACAGTTCCCATCTGACCTCC Gene lists Zhang et al., 2013
Marker34168 chr9 5,429,779 5,430,136 - AACTGGATCAATATGCCATGTGGACGAACT TTCTGGAGGGAAGTTATGCGGTTATAACAG Gene lists Zhang et al., 2013
Marker34303 chr9 20,431,607 20,431,976 + TTTCCTGTATCAGGACCTTGAGTCAGAGGG GTTGCTGGTAGTGGTCTCAGTTTGAAAGAT Gene lists Zhang et al., 2013
Marker34424 chr9 17,282,576 17,282,873 + TGTTCGGTGAACGGGGATGTAAATATAGTG GCCACAAATAGTGGATTATAACATCAATTT Gene lists Zhang et al., 2013
Marker35413 chr9 20,134,060 20,134,354 - TTGATTCAATGTAACTTATAGTTGTTGGAA TTCTCGGTTTCTTGTTCCACCGTCTTCTTC Gene lists Zhang et al., 2013
Marker36794 chr9 16,748,954 16,749,338 - GTATTGAAAAATTATTATTAGAGAGCATAC ATATCTTTTCTCTTTCATTTACTGCCTAAT Gene lists Zhang et al., 2013
Marker37808 chr9 5,418,807 5,419,142 - TTCTATTTTATTTTCTTAGACAAGGATAGC CTTTCCATAAACTTTATAAGTGTCTCTAAT Gene lists Zhang et al., 2013
Marker38587 chr9 20,441,973 20,442,290 + TTCTTGCTCTTCCTTAGTGTCCAACGAAAA CTCCACTTCCCTTTCTGTACGATTTTGCAC Gene lists Zhang et al., 2013
Marker38876 chr9 3,494,052 3,494,340 - AATGTTCAATTATGTACGACATATTACATA ATTAGCATACTCACGCACCTTCCCTCCCTA Gene lists Zhang et al., 2013
Marker39368 chr9 3,592,900 3,593,267 + GGGCATGGGGAAGACAACTAAAAAGGCCAG CACAAGCTCACCTAGGAACAAGATAAGTTC Gene lists Zhang et al., 2013
Marker39918 chr9 3,783,575 3,783,936 - TAGCATGTTATCAGTAGCTCAAGGCATTTC ATTGTAAAATTCAAATATCAACGTAATTCT Gene lists Zhang et al., 2013
Marker40770 chr9 16,738,159 16,738,521 + AGAGATACAAAATGGTGTTTTATGTGAACT GTCCAATAAAATATGATAAAAGAAAAGAAG Gene lists Zhang et al., 2013
Marker41220 chr9 20,089,748 20,090,130 + TCAATGAAAATTTCATAAAATTCCTGCATT GCATGAGAAATTGGCCAGTTCCTACTACAA Gene lists Zhang et al., 2013
Marker4135 chr9 20,128,538 20,128,886 - GATACACATCTGCCTTGTCAGTTGCTCTGG ACCCCTTTACTATGGCCTCTTATTTTTGCA Gene lists Zhang et al., 2013
Marker44231 chr9 3,587,534 3,587,831 - AAAAGACGCTTTACAGAAGTTTTGGAGTTC TGCAATAGAAAGAGATTATGGATAAGTTTA Gene lists Zhang et al., 2013
Marker49133 chr9 5,423,597 5,423,915 + GACTGATCATCATTGAAGCAGCAAACTAAC GTCCCAATCTTTTCAGTTTTAGGCAAAAAT Gene lists Zhang et al., 2013
Marker49936 chr9 20,349,256 20,349,549 + TATCCGATCTAAGTTCAAGTTAGAGTTTTC CCTAACAAAAAAACGTGGATCTTGAAGTGT Gene lists Zhang et al., 2013
Marker5091 chr9 3,779,113 3,779,444 - AACATTCAATGGAAGCGGTGTAATGTGTTA TATAAGGTATTCACAAGGCAAGAGCTCCTC Gene lists Zhang et al., 2013
Marker51211 chr9 3,616,703 3,617,000 - TAATAAAATTTATGAGAATCATGAATTGAT TATAGAAATCTAACATGGTAGCAGAGCAGG Gene lists Zhang et al., 2013
Marker53667 chr9 5,419,779 5,420,094 + GAACAAGATAAACAGAGAAAGAAAGGACTG CCAGCTTAGTTTCATCATCTATGCTACTAT Gene lists Zhang et al., 2013
Marker53861 chr9 20,238,173 20,238,564 - TGGTGCATTCATGAAGTTGTGATGGGGGGG GCATTTTTGTATCAATAAAGTTTAGTGTAA Gene lists Zhang et al., 2013
Marker56248 chr9 3,766,126 3,766,493 - CAAAATTTTATAACTTTTTATTGTTACTAA CTCTGATACCATTTGTCACGAGTATTTCTT Gene lists Zhang et al., 2013
Marker56558 chr9 2,196,040 2,196,329 - GGAGCTGCAAATGATGGGTTATATGACATA AGTACCTTGTACAGTTTAGATACGTAAGTA Gene lists Zhang et al., 2013
Marker57550 chr9 19,985,920 19,986,253 - TGAGAGAAACGTATGTGTATGAGTCTTTGT TGTCTGATTGATCAATTGTTTATCAAATCA Gene lists Zhang et al., 2013
Marker6157 chr9 19,697,901 19,698,220 - CATCAAGAATCAGAAGGAAACAGGGTTGAC ACCATGTAAACAATCATAGAGCAGTTGTGA Gene lists Zhang et al., 2013
Marker9469 chr9 3,661,269 3,661,635 - ACCAAACTGTTGTTGAACTCCTCCCGAGGA GTTTGCTGCATTTGTAGTTCCAAATATGAC Gene lists Zhang et al., 2013
Marker9518 chr9 16,881,641 16,881,968 + AACATCAACCCTGGGAATCATCTTCCTCGT GATAAATTTAGGGTTCTCAGCGACTTTCAG Gene lists Zhang et al., 2013
Marker12350 chr10 1,095,483 1,095,836 - AGATTTCCGTCAAGCCATAACAGTGAGATG GAATCATAGGAACAAGTAGAAGTTCAGAAA Gene lists Zhang et al., 2013
Marker13168 chr10 14,996,584 14,996,922 - TCTCAAATCCTAACCCTATCCCCCATTTTC ATTTTTTAGCAACCGTGAGAGTTGTCTGCC Gene lists Zhang et al., 2013
Marker13338 chr10 15,022,218 15,022,585 + TTAGTTTTCTAGTCACCTATTCTAACATAT GAAAGCCCAAGTCATGAAGACCACATTCAG Gene lists Zhang et al., 2013
Marker15900 chr10 14,619,358 14,619,720 - CTTTGGTATTGGAGCTTCCACCCGTCTCAT ATCTGATATGGATCAGGTGAAATCATGGGA Gene lists Zhang et al., 2013
Marker16359 chr10 1,264,561 1,264,878 - ACAAATGAAAGAAATGATAATGCTTCAACA GTACATCAAAGGCATACAACCTTCACAAGG Gene lists Zhang et al., 2013
Marker16460 chr10 14,482,449 14,482,755 - ACAGTGTCTTCAACTGTTGCGACGTGAGGT ACTATCGCCTTGGCAAATACCATGGCCTAC Gene lists Zhang et al., 2013
Marker16527 chr10 14,584,424 14,584,768 - AACTAACGTGGTTATACAAGTAAACTTATA TCGTGTAACTCGTTCATCACCTTTTTGCTC Gene lists Zhang et al., 2013
Marker18753 chr10 14,170,830 14,171,160 - AATTGATAAAGGCGAATAAACACAACACAC ACTTGCTGCAGCAAGTAGGGAAGTATTTCC Gene lists Zhang et al., 2013
Marker19007 chr10 14,443,865 14,444,171 + CTGAACTTGTTTGGAAGATGTGACTTCAAG TGGACGAATACCAGTGATTTCAACTATTTA Gene lists Zhang et al., 2013
Marker19311 chr10 9,081,849 9,082,217 + ACCATTACCACATGCAAAAATAAGCCTAGC TATTCCAAGGCTAAAAAATAAAAGAAGGAA Gene lists Zhang et al., 2013
Marker19839 chr10 8,724,696 8,725,029 - GCGATAAATATAAAAGGACGGTCCAGAAAT TGACCCAAAACTGGAAAGGTTCGCATTATG Gene lists Zhang et al., 2013
Marker19884 chr10 14,397,652 14,397,964 - TATACACACACAAACAGTCAAACACGGAAA CTTGGATGAGCTTGTAGCGATAAAACCCAA Gene lists Zhang et al., 2013
Marker21439 chr10 14,598,579 14,598,924 - AAAAAAGTAATTGTAATTTACTCGCTAAAG GAAGACTGCATGCATGCTAGGAATGGATGA Gene lists Zhang et al., 2013
Marker21938 chr10 17,328,087 17,328,445 + GCAGTTGTATATATTCTGCTGAAAGAAAAA CTGGCAAATGAGACGTTTTCAATGCATAAA Gene lists Zhang et al., 2013
Marker22411 chr10 4,919,626 4,920,003 + ACGAACCCCTCTCTGATGTAACCATTGACT CTGAAGCCAAAATTTTTTATTGTCGGGTTG Gene lists Zhang et al., 2013
Marker22734 chr10 1,103,698 1,104,026 + CAGTCATAGTGGAAAATGTTTCAGGCCCAC CATTTTGCTATTTTTGCCCTCGTCTCCTCA Gene lists Zhang et al., 2013
Marker23007 chr10 3,817,292 3,817,664 - TTCAAAATGATAGCAAAAAAGATGAAAATT GAGCTTTATCCTAGCTGGATATCAAGTCTG Gene lists Zhang et al., 2013
Marker23028 chr10 17,054,221 17,054,605 + AAGTTACCCTTTCTCAGTTCTAGTCCTGCA GGACACCAAAGATTGATTCACCTTTGAACT Gene lists Zhang et al., 2013
Marker24106 chr10 12,672,206 12,672,561 - ACACGTGTCAGTCAATTATCATCCACAAAA AGTCATCGTCAAGCCCTATTACATTTTCAC Gene lists Zhang et al., 2013
Marker24217 chr10 17,204,641 17,204,943 - TTTGTAAATGATTGTGTTATGTCATCTTCC ATTTGATTTCCAACATACTTCTTGCTTTCG Gene lists Zhang et al., 2013
Marker24237 chr10 14,890,507 14,890,838 - AGTTCAAATTAGTAATCCAACATAAATATG ATAATGTCAGTCTCAGCCCAAACGGAATTT Gene lists Zhang et al., 2013
Marker24699 chr10 17,112,209 17,112,552 + AGTCACATCTCTTCAAAAATAAATTATACT TGAAAACGATGTTACACTTCAATTTGGACC Gene lists Zhang et al., 2013
Marker24766 chr10 14,936,057 14,936,390 + AAAATGTGCAACGCCCGAGTTTGGTATAAC AACAGGTAAAGATAATGCTCAAGGCTAGGT Gene lists Zhang et al., 2013
Marker24833 chr10 1,137,193 1,137,550 + AATTATAGTATTGGATACGTCAAATTTGAG ACACCCCGAAACACAAAAAGGTAGGTTCAA Gene lists Zhang et al., 2013
Marker25085 chr10 1,179,157 1,179,461 + CTTATTTCACAGTTTCAAAGATTTATTTCA CACCCAACATCTGCACACCAAACATAACGC Gene lists Zhang et al., 2013
Marker25289 chr10 17,198,274 17,198,637 - AAGAAATAATATTTCGATATTGGACATATA GTAAGTTTGGGTCTCCTACCATATGCTCGT Gene lists Zhang et al., 2013
Marker25301 chr10 12,650,024 12,650,394 - CGATCATGTGGTATTTTTCATGAAATATCG CTAAAGTTTTTATGAGTGTGTGTGTAATTT Gene lists Zhang et al., 2013
Marker25741 chr10 12,605,828 12,606,212 - CCACGCAACCACCACTCAGTAAAACGTTGC AGGTGCTTCACACCCAAATCAAGGTAAGAA Gene lists Zhang et al., 2013
Marker25971 chr10 12,794,150 12,794,482 + AAGACGGGAGGGGATTCCCGTAAGGATCAA GGGCCTGAAAACAGCCGACTGTGAGGGTTT Gene lists Zhang et al., 2013
Marker26286 chr10 1,228,515 1,228,792 + AAAGAATTGTCATGTAATTTCATTATTCCG GGGAGAGGGAAGAAGAGGCAAGGGACATCA Gene lists Zhang et al., 2013
Marker26357 chr10 14,098,071 14,098,421 - ATAGAATAAAAAGTTCCAGATGAGATCATG AGCTTTTCTAATAAGTGTATTCCTAAGTCT Gene lists Zhang et al., 2013
Marker26404 chr10 17,195,246 17,195,566 + TGTTGTATGAAGTAATAACGATATAAATTT TTTGCACTATCATGATCACGATCGAGTGGC Gene lists Zhang et al., 2013
Marker26781 chr10 14,617,930 14,618,264 + AAATTGGTACGATAGAAATTTTTATTTATC AGATGCACTGGGGAGTAGCAGAGTTAGGCC Gene lists Zhang et al., 2013
Marker26797 chr10 15,767,746 15,768,069 - TAACCTGAAGTTGAAGCCAAAGGGTTTTCT ATGAATTTTCAGAAAGAAATCATCCTAGCC Gene lists Zhang et al., 2013
Marker27151 chr10 14,403,968 14,404,335 + CAATACCGACTGATATTGTTCACACACTAA TATTTTATGATGACTATTACATTCATTTAT Gene lists Zhang et al., 2013
Marker29158 chr10 14,644,746 14,645,043 - GGCTTCATCAGACTTTCCTTCAGCTTTCAA TTTCTGGAGCCACCTGCACAGAGCTATATA Gene lists Zhang et al., 2013
Marker29558 chr10 14,635,325 14,635,690 + TAAGAGAGCTACTAAAACACTATTTTTTGA ATAGGAAAATACTAAGTACTATTGCTTGCA Gene lists Zhang et al., 2013
Marker2974 chr10 1,240,825 1,241,183 - TGTTGCACGTGGGGGAGTGATTGATGAAGA TCCTGATTGTAATTTTTGCACCATGCTCAT Gene lists Zhang et al., 2013
Marker30182 chr10 14,633,589 14,633,968 - CATCAATTATGATTTGGTGCTTTATGGAAA GAAAAAATGTGTGCTTTGTCCTAAAAATGA Gene lists Zhang et al., 2013
Marker31034 chr10 1,246,900 1,247,210 + GTTGGGCCCACAAATGGCCAGATATAAATA CACATTCAATTCAAATTCCATTTTTTCGAA Gene lists Zhang et al., 2013
Marker31250 chr10 12,849,158 12,849,452 - GAATAGGATATGCTGCGTGATTCTTGTATG CTTGAAGTATCAAGTAAGGTTGCTGAAAGG Gene lists Zhang et al., 2013
Marker32188 chr10 14,931,675 14,932,057 - ATCTCTTACATTCCTTCAAGAGATGTTCAT GCATCTCGAATTTCCAAATACTAAGTTTCA Gene lists Zhang et al., 2013
Marker33103 chr10 14,523,390 14,523,692 - CAAAGAATTTATGGAAGACAAACTCCCTCT TACGTCGAAAGACAACCATGAGCCGATGTT Gene lists Zhang et al., 2013
Marker33589 chr10 1,241,188 1,241,568 + TGATCCTGACACCTTTTTTCATCTTTGCAA TAACTCATAAGTTAGTGTTACAGACAAGAG Gene lists Zhang et al., 2013
Marker35353 chr10 16,290,206 16,290,520 + TCTGTTTTGGATTTCAAAATTAGGAGGAAA GACAAAGAATGTGGATTACTTCCAAAACTT Gene lists Zhang et al., 2013
Marker36018 chr10 1,168,448 1,168,801 + GTGCATGATTCTTTGTATCGATTCCACACA AGAGTAAAATATATAAATCAATACACTAAT Gene lists Zhang et al., 2013
Marker36180 chr10 16,079,477 16,079,817 - ATCACAAAAAATTTATATGTAATCATATCA CAAGATGCCAACAATTTCTTAGCTGGGTTG Gene lists Zhang et al., 2013
Marker37264 chr10 14,439,735 14,440,030 - AATCTCCCTCTGAAGACTCAAAAAAAAACA CCCAGTCATACTCCCTTATCCACTGCTAGA Gene lists Zhang et al., 2013
Marker37799 chr10 14,996,280 14,996,579 - GTGGCCGAGGACTTGCTCTCTGAATTTTTT AACCCCTCATTTTACTTTTGGCAAAATATT Gene lists Zhang et al., 2013
Marker37981 chr10 17,182,907 17,183,214 + TTGGCACAAGTTTCTATCTTGGGCTTGAAG ATCTCATCACCAAACTCCTCAGGTTCTATC Gene lists Zhang et al., 2013
Marker38680 chr10 14,694,318 14,694,702 - GGGGTCTTATAATTCCTCATTTGTGTGTTC GGTTCAAGGTTCTTGTATTCACACTCCTAG Gene lists Zhang et al., 2013
Marker38912 chr10 9,881,747 9,882,127 + ATAGTGAGGAAATAGGAGGTGAAGATATTT TATGCTCCAGAAGAGGTGAGAACCGATGAA Gene lists Zhang et al., 2013
Marker39690 chr10 14,076,696 14,077,059 - GTAATACACCAATTCAACCAATTGATCAAT TCATGAAAAATTGATCAATAATTCTATTTT Gene lists Zhang et al., 2013
Marker40062 chr10 15,525,195 15,525,539 + GTTTTCAGTTTGTTCAGACTTGTTGTTCCT ATGAAGAACTATAAATGTTGACAAGATTGA Gene lists Zhang et al., 2013
Marker41566 chr10 17,357,597 17,357,911 + ATCATGCATTATATAACAAAATCAGATGTA CGCTCCGTAGTCCGTACCAACAAAACTTGT Gene lists Zhang et al., 2013
Marker43126 chr10 15,123,294 15,123,679 + GAAAGTAAGACAACTACAGACAAACATCAT GTCAGCAAGTCCAGGGAGTATTGAATTGAA Gene lists Zhang et al., 2013
Marker44609 chr10 8,951,275 8,951,548 - GGACCCCAATAGAGTCCATATCAGCACGGT CTGAGAAGGATGGTGTTTTGAACGGTTTTA Gene lists Zhang et al., 2013
Marker44720 chr10 17,152,155 17,152,454 + TTTATATATACACACAAAAACAACTACATC GCAATTTCATCTGGTAAGTTCCGCATCTTG Gene lists Zhang et al., 2013
Marker45112 chr10 14,125,934 14,126,315 + TGCTAGAGTAGTGATATTTCCATGAATCGT ACCATTTGGCATAATTACACAAATTTGTCA Gene lists Zhang et al., 2013
Marker45261 chr10 12,724,107 12,724,396 + AAAGAACCTTCAGCTTATGGAAGAGGAGGG TTGTGGAGTTTTGCATGCAATACTGTGATC Gene lists Zhang et al., 2013
Marker47933 chr10 1,102,325 1,102,653 - ATTTATTATCAGGTCAAATTTTCAGATGGT CTATTAGCTTCCAGGAAATGAAAGCAGGAT Gene lists Zhang et al., 2013
Marker50182 chr10 14,680,849 14,681,210 - ATATTAGAACAAATCGTAGATCACAGGCTT GTTAGTCAAGTTTTACCGAACTTGCTTATA Gene lists Zhang et al., 2013
Marker51852 chr10 14,951,821 14,952,098 + AGAACAAGAGGATATATGTGAGATTTGATG ATGTTGCATGTTTTAGATATCCGAAAGAAC Gene lists Zhang et al., 2013
Marker52067 chr10 1,235,664 1,235,940 + CTAATTTATGCTAATAACTCCAGGTTGGTT TGACACTATTATTAGGTGCTCCATTTTGAA Gene lists Zhang et al., 2013
Marker52816 chr10 14,933,405 14,933,768 + CTTAGAACCCATTTTGCCTGTGCTGGCAAA GCTCCGTCAATCTTTCAATTTTCCATGTAG Gene lists Zhang et al., 2013
Marker54560 chr10 15,147,398 15,147,713 - TTTTGAAGCAACTGATAAATGTTGAAAGAT GGCTGACTTTTGATGTCTCTACTGTTTTCT Gene lists Zhang et al., 2013
Marker5629 chr10 14,574,987 14,575,345 + ATAACAGACGAGAAAGAAAGATCTGGCCTT ACAGAATCATTACAGAGAGGAACCTTACCA Gene lists Zhang et al., 2013
Marker57606 chr10 17,829,839 17,830,133 + ATTTGTACATGTCGTGCATTCATAATTATC ATGCAAATATGGACCCCAATTTTCTCCTTT Gene lists Zhang et al., 2013
Marker58063 chr10 12,767,750 12,768,140 + GTAGTACAATTTGCAAGAAATGCTAAACCA ATAACTTCATCCAAATCAGAAAATGAATCA Gene lists Zhang et al., 2013
Marker58686 chr10 12,834,998 12,835,352 - CTAAAAGAATACAAGTGACACATCAAAACT CAAATAAGTGACAACATTATGAGTTTTCAG Gene lists Zhang et al., 2013
Marker59803 chr10 14,288,826 14,289,189 + AACGATAAAATTGAATCAAGATTATCATAA AATGAATCGGGGATAAATATGAATTTTTAT Gene lists Zhang et al., 2013
Marker60576 chr10 14,445,482 14,445,863 + AACTATATTTACTGACAAAAACCAGTAATT GTCCACATTTGACGACTTCTCCATCCCAAA Gene lists Zhang et al., 2013
Marker9517 chr10 17,244,547 17,244,913 - TTGCTGTGGTGAGATATGCTGATCCAAACG CAAAAACATATTTGTTGCCCAGAGTAACTT Gene lists Zhang et al., 2013
Marker10687 chr11 7,085,618 7,085,951 + CACAGTCCAGTGGAGATCGTCATCTTCTCA ACAATTATGGTTCATAGATGGAAAATCAAT Gene lists Zhang et al., 2013
Marker10765 chr11 13,389,793 13,390,148 - AAAAGTAGATCCTTCTGGTAATGCTGGATG TGTCGCAGGGATCAAAAATATTGTCCCTGG Gene lists Zhang et al., 2013
Marker13097 chr11 13,849,460 13,849,796 + TTACCTTCCACTGTTGAACAGTCTAAAGAA ATAATCCCTACCATTACCATTTGGAAAGTA Gene lists Zhang et al., 2013
Marker13134 chr11 12,927,836 12,928,187 - CGCCAATTATCTAACCTAATATAGACTTTC TCATGATTCAGTAAGGCTTCAGAAATATAG Gene lists Zhang et al., 2013
Marker15445 chr11 12,735,276 12,735,624 - GCATGTGTAGAGTCTTTTTCACATAAATGA TATATTTTTCGACATCAACGTATATTGTTG Gene lists Zhang et al., 2013
Marker16811 chr11 1,762,621 1,762,967 + TATCTACTGTTCGACTCTTACACTGCAAAA ATGCCTATTGAGCATCATCCAAGGGCCAAT Gene lists Zhang et al., 2013
Marker16900 chr11 13,780,792 13,781,136 + ATGGATGGCTTTCCTTTTCCCTCACATACC CAATTTATCAATTGACTTCCACCAAACAAC Gene lists Zhang et al., 2013
Marker20164 chr11 12,826,730 12,827,101 + GCTGATCAGTTTTACTTTCCTTTTCCTTGT TTTTCCCAGTTATCTGAATGGGTGTCTAGT Gene lists Zhang et al., 2013
Marker21079 chr11 445,479 445,805 - CTTCTTATTACGAGGCATATTCTGAGCATA ACATTGAGTCGCTTCTTCATCGTCTTACAA Gene lists Zhang et al., 2013
Marker21338 chr11 12,636,293 12,636,653 - ACATGCCAAATCTGCAAAAGTGAAGGGCAC TTAGGGGTCTTTGCCAGCAATTATTGTATG Gene lists Zhang et al., 2013
Marker21993 chr11 12,919,567 12,919,907 - CAATAATAGCCGCAATCTCCTTGTTAGCTG AGCATGTCATTGCTATTGTCAACAACAAGT Gene lists Zhang et al., 2013
Marker22052 chr11 9,680,967 9,681,335 + ACAGGCTATCTCAGGCAAAGGTTTATGGAC ATCACACTCTTTCTTCCAAGACATACTACC Gene lists Zhang et al., 2013
Marker22269 chr11 13,822,888 13,823,240 - GGTAGCAAATGAAAGTGGAAAACCGTGGCA TGATGGCTTTTGTCCACCTTTCAATGGGAC Gene lists Zhang et al., 2013
Marker22879 chr11 993,030 993,371 - CATCTTGTAAAGCGAGTGATTCATTCTTTA TTATGCTGAGGCTCTTGTGTAAAATACAAT Gene lists Zhang et al., 2013
Marker23079 chr11 9,730,209 9,730,543 - TGAGAATACAAATGAACAAACATAATTTCA TTCGTGTATTGAAATATATTTCATCTAAAT Gene lists Zhang et al., 2013
Marker23308 chr11 9,680,539 9,680,838 - ATGGTAAACTATCTCCTTTGTAGTGGTTGA TCCAACAGTAGTTCCAGGTGGAACCTCCTA Gene lists Zhang et al., 2013
Marker24068 chr11 13,501,290 13,501,681 + CATTCAACGAGCAAAAACCATGATGAGAGG CTTCCTAAACCAGTTCCTTGAGAGTTAGCA Gene lists Zhang et al., 2013
Marker24220 chr11 5,216,423 5,217,001 + GACTATATATCTTAGCATTCTATATCTTTT CTTTCGCTCTTGAGGTCGAAGCCTCCGAAT Gene lists Zhang et al., 2013
Marker26113 chr11 1,925,440 1,925,753 - GCCCTAAGTGATAGTTAGTGTTGAACCAAA TTAGCAATAGTAGTGGCTGTGTAAGGGTGT Gene lists Zhang et al., 2013
Marker26254 chr11 12,623,815 12,624,189 + CAACATCAGCTCACAAAGAACTAGTTCATC ACTGTCACTTTTTCTGCTTTGTAGCTAGAA Gene lists Zhang et al., 2013
Marker27109 chr11 9,622,048 9,622,402 + AGTGCAAAATGGAACAGTTTGATGATTACA AATTTTCGTAGTCACTGTTGATCTATTCTG Gene lists Zhang et al., 2013
Marker27954 chr11 13,507,708 13,508,007 + CTTTTGGGGGCTTTCCATCACAACTAAGTC CTGAAAACTGTGGATCAGTGCTTGCATCAT Gene lists Zhang et al., 2013
Marker28160 chr11 9,458,240 9,458,623 - ACAGACAAAATAACAGATGTCGTTGAGTGA GTTGTGCTTTCTGCAATAATAATATTAGTG Gene lists Zhang et al., 2013
Marker30514 chr11 1,494,159 1,494,523 + AAAGCTCTTTGACATCCGAAACAAACCGTT TGCCTAGCTTGTGGGATTGGCCCAATAATT Gene lists Zhang et al., 2013
Marker30737 chr11 12,631,564 12,631,854 - GGCAGCATAGGCGGATGTTTTGCTTCCCCC ACGGGCTCATATTGCACCGATTATTTGTGG Gene lists Zhang et al., 2013
Marker31474 chr11 12,802,519 12,802,910 - TGATAAAATTTGGAGCATTTCCAGCATTAC GATCCTCCACACGCTTTCTCCGCTGCTCTT Gene lists Zhang et al., 2013
Marker32194 chr11 12,630,906 12,631,209 + AATACGTGAGCATTGCATGCAAGGAAAATG AAGTAGAAGGTTTTTCATCCATTCACAATC Gene lists Zhang et al., 2013
Marker32330 chr11 8,694,564 8,694,866 + ACTTATATGTGTATGTGGAGGAAATCGCAT GAAAATTTCGTTCCTAACATATGTTTCGAG Gene lists Zhang et al., 2013
Marker32379 chr11 373,590 373,961 + TGTAAACGGCAACGGGACTACTCTAAAGAG GTTTGCGTTTGACTTGAATAGATGCAATTT Gene lists Zhang et al., 2013
Marker32834 chr11 1,344,047 1,344,435 - AACACCAATGAAACTGATGTTTCATGTTCT GAATAATTTTTGAGTAATGCCGGTTTGCTC Gene lists Zhang et al., 2013
Marker33685 chr11 9,534,566 9,534,938 + TGTGAAGGTCTGTTTGCTTGCCTGTTACTT TAAATTGTTCCGTGACTTTGCCTATTACTC Gene lists Zhang et al., 2013
Marker33786 chr11 13,125,303 13,125,635 + GAAGAAGACGACAAAAACAAAAAGTTAGAG TGACTCGATGTGAGCATTTCAATACTCAAA Gene lists Zhang et al., 2013
Marker35267 chr11 13,517,945 13,518,324 - TAACCCAACTTTGCCTCTTGGACAGGATAT TAGGCAAAATCTTCTATAGATAGCGATATA Gene lists Zhang et al., 2013
Marker36471 chr11 12,673,421 12,673,766 - GCTCTTGGAGCTAAAAGAAGAAGCAATTAT TCCAATTATCTTTGGTAATTATATACATTC Gene lists Zhang et al., 2013
Marker37979 chr11 2,323,370 2,323,669 + GTGTGGGGGTATTGTTGTTGAGCATACTTG GGAATGCATGATCTAATTACTATGACATAA Gene lists Zhang et al., 2013
Marker38489 chr11 11,392,817 11,393,197 - TGACACAAACAAGGCAGCAGCAGACATGAG TGCAGTGCGAGCAAATTATCACCAACTTTC Gene lists Zhang et al., 2013
Marker3988 chr11 5,525,865 5,530,700 + AGAGTTCTATTTCTCGTGCGACATATTTGT TAGTCATGGCGTTTTTCCTGAACCAATACG Gene lists Zhang et al., 2013
Marker41627 chr11 454,751 455,146 + GTTATTAGGATGAGGGGTTGGAAATCGGAG TCCCTGTTGGAGCAATTTTGGCAAGATACC Gene lists Zhang et al., 2013
Marker42061 chr11 13,880,125 13,880,418 + ATGTTACTGCCAGCCTCTATCTTCCAGTAC TCAGTCGGTTGAAAACAAGAGGCTTTTGCT Gene lists Zhang et al., 2013
Marker42450 chr11 9,579,974 9,580,308 - AAATGCAAAATGATTGATGAAATAAGCATG ATAGTTCAATATATACTATTTTTCTTCTAA Gene lists Zhang et al., 2013
Marker43453 chr11 12,966,039 12,966,395 + CTGCAAAGAAAGCAGAAAACTTCATCAACC GTTTTCTTCCAAGCTCAAGAGAAACTTCTA Gene lists Zhang et al., 2013
Marker44785 chr11 12,727,840 12,728,159 - TTGATTTCTGTGTTCATGATTCGTCAATTA AGCCGCGTAGCTAATTCCATTGAATCTCCA Gene lists Zhang et al., 2013
Marker45559 chr11 9,576,625 9,576,968 + ATAAAAAAAAGAAATAAATGATAAAACTTG ACCTCGACAAGCACTAACTAAAAACATACA Gene lists Zhang et al., 2013
Marker46346 chr11 12,869,129 12,869,505 - TACGAGACATCATTGATTTCTACGAGCTTC GACCTGCAAGCAGGTGATTTTACATAATTT Gene lists Zhang et al., 2013
Marker46837 chr11 13,494,271 13,494,586 + TATTCATCAAATTCCCTATCGTTTTTTGAT AACGGAGAATAGAAGAAGGAAAAATGGCTC Gene lists Zhang et al., 2013
Marker47062 chr11 13,530,281 13,530,610 - TCTCTTCCATTGTAAATTTGCTGATAACAA TTTGCAGAGTTTCAATCTTTATAAATGAAT Gene lists Zhang et al., 2013
Marker47922 chr11 391,804 392,126 + TTGAATCCGACTGGTTCTAGTTGAACAAAA CTATTACAATAAGAATGCACAATAAACTTA Gene lists Zhang et al., 2013
Marker50168 chr11 13,724,433 13,724,746 + AGAATGAGAAAACTATTCAAATGTGCATAC AGTGGATCCCAATCTGTTATTTCTAATTCC Gene lists Zhang et al., 2013
Marker50232 chr11 1,112,536 1,112,887 + TTGATATATTTACCATTCAACCGTGTCGCT ATTTGACATATCTTATGGGGTAAATTGCAT Gene lists Zhang et al., 2013
Marker52757 chr11 8,671,575 8,671,926 + ATTAGAATCCCCTTCATCTTTTGTTGCCAA ATTTCAGAAAATTATCGCCCAAAATAGATA Gene lists Zhang et al., 2013
Marker53658 chr11 305,022 305,387 - TACATAGAGACAAGATAATGTTATATAGTT CATGTTATTGAACAAAAATATGTTTGCAAA Gene lists Zhang et al., 2013
Marker54973 chr11 12,871,368 12,871,661 + TTGTTTATTTTTTGTTTTATAAATGGGATA TACACATACTACTACAATATATCAACTCTC Gene lists Zhang et al., 2013
Marker57672 chr11 1,481,936 1,482,329 - GTATTGAAATTTCTCGATTTTGAAAAATTA AGACAGGTACTACTGCTTCATGATCTTACT Gene lists Zhang et al., 2013
Marker58058 chr11 12,956,307 12,956,638 - AGGCATACATATATGAATTTTGTGGTTTAG CAAGGAACATTAGGTATGCCCTTCATGAAA Gene lists Zhang et al., 2013
Marker60468 chr11 2,673,397 2,673,704 - CGTGAAGAGCTGTTTACCGATTTACAAGCA TTGATCAATAACACAGTAGGAAGGTTCTTT Gene lists Zhang et al., 2013
Marker6123 chr11 9,461,327 9,461,681 + GTGCACAAACAACAACCCCACATTATCAAC TATTTCCACATAATGTTACAGTAACGATCA Gene lists Zhang et al., 2013
Marker7194 chr11 11,594,275 11,594,668 + TTCGACAATGGCAGGTTGGAGACAGGGGGT CAATGCCAGAAAAAGTAGTGCAAGGTACAC Gene lists Zhang et al., 2013
Marker7287 chr11 9,613,827 9,614,183 + CTGCTTTCTGGATAAAGATGTTTTTGCATG TCTAAACGCTTTCAGAAATCTATTGTTGGC Gene lists Zhang et al., 2013
Marker8461 chr11 1,348,622 1,348,977 + CCCCTTGAAACCGTAATTCATCAACAGGTG TCAAAATAAATAAAAAAGGAAGCTAACAGA Gene lists Zhang et al., 2013
Marker1177 chr12 6,564,104 6,564,422 + TGCCTGCATTATGGAAACTGGTTTACTCCC ACTGTTTGGCAACACAATTTTGTGGGTATT Gene lists Zhang et al., 2013
Marker12212 chr12 14,823,114 14,823,478 - ACAAGAACTTAGTTTACCTAGTGTTCTGAT GGGAATGGATTGACAAGATTCAAAAAGAAA Gene lists Zhang et al., 2013
Marker13115 chr12 14,808,785 14,809,157 - TTGTTATGTCTTGCATTTTATCAGAAGTTT GAATGTTGATCTATATGTCGTGGAAGTTTC Gene lists Zhang et al., 2013
Marker14711 chr12 14,132,518 14,132,881 + TGGAACATGAAGGCAGTCAGCAGAAGTGAT CAAATCTAGGGTGTTTGGAGATTACCCAAT Gene lists Zhang et al., 2013
Marker14814 chr12 13,828,594 13,828,973 + ATCTCACTCTGTTGTCTTGTGAGGTTTCTA GTTGCCTTACAGAACGATGCCTGAGGGGAA Gene lists Zhang et al., 2013
Marker16833 chr12 14,787,274 14,787,652 - CAAAAAGGGCACGACAGAAAGAGAGAATAT TATAAAGGCTTTTACTTGTTGGGGATATTT Gene lists Zhang et al., 2013
Marker17001 chr12 13,692,304 13,692,648 + TTGAAGGTCCAAGGACCCGGCTCTCCGACG CGTGGCTGCGGTGGGTAAAAGGGCTGCCCG Gene lists Zhang et al., 2013
Marker17555 chr12 14,102,479 14,102,819 - GGCATCAGGCCTCGTTGAGGAGTTGGTGTA ATTGCTCTTTTATTGGTCTAACAAATCTTA Gene lists Zhang et al., 2013
Marker19031 chr12 13,670,966 13,671,299 - GGAACTCTCCCACCCCACCCCGCAAAAAAA CCGAAGTGATGTGCGAAAATAAATGCCAAA Gene lists Zhang et al., 2013
Marker20385 chr12 14,134,658 14,134,988 - TGATTACTTACCCGAGTAAGATAGTGGTAT TCGGCCACTTGTTATCCTTGCTCTTACAAC Gene lists Zhang et al., 2013
Marker20404 chr12 13,663,984 13,664,315 - AAAGAAAAAAGGAAATCCTCGAGCATTCAA AACCAGCAAAACAACAAAGAACTCCAAGAA Gene lists Zhang et al., 2013
Marker2056 chr12 10,063,270 10,063,612 - TGTTGTTACTATATTTGGGCAGATATATTT TTGCTCTGCGTGATGAGCTGAATGGATGTC Gene lists Zhang et al., 2013
Marker2195 chr12 2,264,667 2,265,067 + CGCCAAGCTACCAAAGCATTTGATTAGAAT CTACTTGGGGTCCTAATGCAAGCAGCCCCA Gene lists Zhang et al., 2013
Marker22652 chr12 10,363,203 10,363,517 - ATTCATGAACAAGCAATTTATTCAATATGC ATGTGGATAAAATAAATAAAGCTCAATGCG Gene lists Zhang et al., 2013
Marker22836 chr12 14,255,013 14,255,349 - TGGTTGAAATGCCCCTGGATCAGCGTATGT TGCTCCAATCTGCACCAATATTGCAGCATT Gene lists Zhang et al., 2013
Marker24275 chr12 14,969,805 14,970,186 - TGAAACTTTATTGTTGCAATTAGAAGTGTA CATCATAAGCCTGATTGAAGTTCAAATAAC Gene lists Zhang et al., 2013
Marker25490 chr12 10,345,214 10,345,580 - CACCGAGGGCATTCTGTACCCTGATAGTGT AATTTTTCTATGGGAACTGATTACATTCTT Gene lists Zhang et al., 2013
Marker25590 chr12 12,044,381 12,044,684 + GGTGGATATAAGATGAAAATGGTTGGTTTC AGGGTTGACCCAGTCAAACCTTGCTTCATT Gene lists Zhang et al., 2013
Marker26214 chr12 14,174,031 14,174,367 - ACTTCGTATATATGCACATGGAGAATGGTC CAGAAGTAAATAAAGAAACTGAGGTAAAAG Gene lists Zhang et al., 2013
Marker2663 chr12 10,097,262 10,097,605 + CCCCTACATTAGACATCTTTTCCACATGTT AACTAACCCGAAAACTTATCGGCAAAGCGA Gene lists Zhang et al., 2013
Marker27401 chr12 13,693,444 13,693,814 + GTTGCTTTCTCTTAGTTGATGAGATTGAAA CTTCGGTAGATGCAATTTTTTCGGAATTAT Gene lists Zhang et al., 2013
Marker27967 chr12 10,076,439 10,076,753 - TTATGTAAATGGCATTTCAGATTATCTCAT TGAACAAGCTGCGGAACTAAACTTGACTGA Gene lists Zhang et al., 2013
Marker28089 chr12 14,763,931 14,764,268 - TTCTTTTATGTCACCAAAGCAATGCTGATT TTGACCTAGATCCTGCAAGGATCACATGAT Gene lists Zhang et al., 2013
Marker28221 chr12 11,768,224 11,768,540 + TAATGTACGTACAGGAGAGGGAATAATGGT TGTCTGCTATGACAAATATGTGTGTGTGGT Gene lists Zhang et al., 2013
Marker28753 chr12 10,346,809 10,347,152 + AGAAGTCAAACCATGACAATGATATAATTA GGGAAAAGTACCAATTCAAATCCCTTCCTA Gene lists Zhang et al., 2013
Marker28934 chr12 14,870,371 14,870,709 + AGTTGTGCCAACTGAAGTTATGTAGGACTG TTTTTTTCAGTAAAAGTCTGACATTGTAAG Gene lists Zhang et al., 2013
Marker29093 chr12 14,800,839 14,801,436 - TTCTCACAGTAAAGGAGATAATTGAAATAT TTTCAGATAGAGTAGGAAGCAAGGAGGTAG Gene lists Zhang et al., 2013
Marker29307 chr12 10,390,375 10,390,680 + AGTATATATACGGATGGTCAAATCGAGCTT TTCTTTGGCCTGTCGAGTAAATCGCTTAGA Gene lists Zhang et al., 2013
Marker30536 chr12 14,195,021 14,195,395 + TAACAGCATGTTACAAAATGTAAATTTTAT TTGCCGCCCTATTCGTGACTATATCGCCTC Gene lists Zhang et al., 2013
Marker30568 chr12 14,857,347 14,857,658 + CAACGACTACATGTTGTACTATATCTGCCC CATGTGAAGTTATGAATTTCTTTTTCTAAA Gene lists Zhang et al., 2013
Marker30689 chr12 10,265,506 10,265,843 - AGCCCACATGCCAATCATATGTGGCAAGCA TCTTATCCTCAACAGGTGAAGTTCATTTGT Gene lists Zhang et al., 2013
Marker31176 chr12 14,160,222 14,160,609 - TTTTCCATATCACTCAACTTTTTATAGCAC AAATCAACTTGAAAAATTCCGCTACAGCAG Gene lists Zhang et al., 2013
Marker31797 chr12 10,041,823 10,042,192 - GAAGAACATTGGAGATGCGGGGTATCGATC ACTATTGATTTATTACTAATTGATTATAAA Gene lists Zhang et al., 2013
Marker31867 chr12 14,199,495 14,199,895 - AAGAGATGCTGATGCAGAAGCAAAACCTCA TTTTGCAAATTGGTGACCACCTAAACGACC Gene lists Zhang et al., 2013
Marker32612 chr12 14,757,492 14,757,803 - ATCCAGCAAAATGGCAGAAAAGTTCCTTCG ACCAGGGGCAGGCAAACTTCAGTGAAGTTT Gene lists Zhang et al., 2013
Marker32718 chr12 10,271,598 10,271,916 + GTCGTTCATCTTTCTCTAACTTGTTGGGTG ATAGCTTGCCAATCTACTGATAAGAAATAA Gene lists Zhang et al., 2013
Marker34003 chr12 15,009,958 15,010,259 + AAAAAATTGATTAGGGAAAAAAGTAAGCTT GTTTTGGATGCCACTATTGCATATTTTCAA Gene lists Zhang et al., 2013
Marker34435 chr12 12,019,738 12,020,036 - TGACTTGCACATGTAGAAAGTGCTGTTTAG AAAATTCCAAAGGGGTCGATAGAACCGAGT Gene lists Zhang et al., 2013
Marker35307 chr12 15,000,381 15,000,688 + TGTCCGAGTAATCTCTATTTGGTGCCACTG AATATACATGTAGTATGGTTGATTTACATT Gene lists Zhang et al., 2013
Marker36558 chr12 10,279,633 10,280,008 + ATTGCGTAAATTTGGCAGAGTTTCCTAGAT AATTCCTAGGCATACAATGATGAAGCATCA Gene lists Zhang et al., 2013
Marker37207 chr12 10,291,827 10,292,179 - ATCTTCTTTTATTGTTTTACATGTGAAAGT GTATCTAATGTTTATTCTTTTTGCTCTAGT Gene lists Zhang et al., 2013
Marker37475 chr12 14,141,409 14,141,760 - AGTTTGGTCATTAGTATTCAGCAAATTCTC GCGACTCAGACTACAAGCAAGGGAAATTTT Gene lists Zhang et al., 2013
Marker3790 chr12 14,876,397 14,876,713 + GAGAAATGATATGGAATAGGGAGGTTAGGA CTTTCATTGTTCTATGTGTTTATCTGGAGT Gene lists Zhang et al., 2013
Marker40254 chr12 14,152,687 14,153,049 + ACACATATTATGCATTATATTCTTATTTCT AAACTCATTGGATTGATTCGAGCTCAATAT Gene lists Zhang et al., 2013
Marker40688 chr12 14,926,182 14,926,485 + CCGGGGGTTTGGCGTTGTTACTGGGTAAGG CCCCCTCAGAAAATCTACAGCAAAATATTT Gene lists Zhang et al., 2013
Marker41317 chr12 14,976,216 14,976,513 - ATCACAACACAAAGACAAAGAATGCATCTC AATTGATGCAAGAACTGATTGTTTCAATTA Gene lists Zhang et al., 2013
Marker41452 chr12 14,275,468 14,275,775 - GCTGTCCTCAGAGAAAGAATTATCAGAAAA AGAAAAGAGCTCTGAAGATACTGCAATGGT Gene lists Zhang et al., 2013
Marker41617 chr12 14,960,327 14,960,717 + TTGGTTGTGCCTGTTTGCTATAAGATTCTT GAAAAGCTCAGATAAGTGCAGGTTGATTGA Gene lists Zhang et al., 2013
Marker43919 chr12 12,025,998 12,026,327 + AGAAAATCCAATTTCGATTGATTAGGACAA CTCTGGGTTCATCCTGTTCTTTGTTGCTTG Gene lists Zhang et al., 2013
Marker44233 chr12 14,912,623 14,913,019 - AGAGTTACCACCATAGGCAAACGGACCAAA CATTTTCTCTAAGCTTCTCCATCATTTCTT Gene lists Zhang et al., 2013
Marker45850 chr12 13,653,798 13,654,103 - GCCACCAACATGATTCTGGGCCTCAATGTC CAGTTCAACCCTTTCTCCGCCGTGCAAGAT Gene lists Zhang et al., 2013
Marker46932 chr12 13,672,371 13,672,790 - TAAACACCTCACGCCTGGCAGATCCAATCA GGACAGAAATTGATTTCAAGATAGACAAAA Gene lists Zhang et al., 2013
Marker47012 chr12 10,373,591 10,374,000 + GAAATAGTTATCTTATCGTGAAAGAGCTTC AGGTATTGTGCAATTCATTATCCTTTCTTA Gene lists Zhang et al., 2013
Marker48615 chr12 11,783,105 11,783,396 + GCTTTGATCTATTGATGGAGCAAACTCCTG CCCTCTCATTTTATGGCTTGACATGAACCA Gene lists Zhang et al., 2013
Marker49868 chr12 14,199,900 14,200,350 - CAGATCCTTCATTTATATAGCTTCTTGATC GCCAAAACTTACAGCAAGGTATGATCAATT Gene lists Zhang et al., 2013
Marker51137 chr12 13,696,497 13,696,818 + TTTATTTTATAATACAAATCTGCTTGTATA GAAGTAGAAAGAAGAGATAGAAGCTCTACC Gene lists Zhang et al., 2013
Marker52627 chr12 10,239,030 10,239,405 + CGACTATAGTTCACACCTTGCAGCAAAGAG TCAGTTTTTGGGGGTGCATTTCAGATGATT Gene lists Zhang et al., 2013
Marker54488 chr12 13,735,750 13,736,053 - TAATTTACGTAAAATGAGATAAATACTCAT TGAAACAGAAGTAAAATTGATATAACCTCT Gene lists Zhang et al., 2013
Marker58170 chr12 14,931,280 14,931,570 - CATCTTCCTCTTTCAGCGCAAAATCGCCTT TTTGTATATTGGCATAGAGAGGTTTGGAGC Gene lists Zhang et al., 2013
Marker60173 chr12 14,936,969 14,937,298 + AATGATCTTCTAAAATTCAAAAGTCTAATT TTGCAAAGCTTAGCAGGGATGGTGGCTGTC Gene lists Zhang et al., 2013
Marker7475 chr12 13,127,876 13,135,067 + TTAGAGAATGATCAGAAACAGCCAAAAGCC AGGTACCCTTATCACAAGACCATACCAAGA Gene lists Zhang et al., 2013
Marker8816 chr12 14,919,703 14,920,047 - GGACAAATGTTCAGAATCTTACATCTCAGT GATGAATCGCCAGCAGTCATATATGGAACT Gene lists Zhang et al., 2013
Marker8971 chr12 10,254,909 10,255,308 - TTTTTGCCATCTTGATTCTTGTTTGCAGCC CTATAACTTTTCTTGATTTCCAGCCTCTAC Gene lists Zhang et al., 2013
Marker10852 chr13 11,699,538 11,699,908 + AAAGCAACCAATGCAATCAACAAGTAATGC CTGATGGATGTGCTGGGGCGCGGAGAATAA Gene lists Zhang et al., 2013
Marker11658 chr13 11,610,434 11,610,811 + GGAGATTATTATAATGTGTTCCTACTCGTG TAACTTTTCTTTATCTTGTACATTGTACTG Gene lists Zhang et al., 2013
Marker11840 chr13 11,521,386 11,521,774 + CACTAAGAATCCTCTGTCACACATCTTCAA AGCCAAAGGACAAAAGTATGTTTAGGGATC Gene lists Zhang et al., 2013
Marker13295 chr13 11,496,529 11,496,869 - AGGGCAATTCAAAAAGAAAGTCAGAGCATT TTCGTCAGTCCAAATTCACCGAATATGCTA Gene lists Zhang et al., 2013
Marker14203 chr13 11,505,949 11,506,268 - AGCCCGCACAACATCAAACCTGGTGCACTA CATATACCTGACCCAATATCAAACATAACG Gene lists Zhang et al., 2013
Marker16817 chr13 11,713,192 11,713,536 - TTGGTATTTACAAGAAAAAATGAACAATAA AGTGTGCAAGTATTGTAAAGCTTCCAGCCA Gene lists Zhang et al., 2013
Marker17910 chr13 11,588,774 11,589,079 - TCCATGCCCGCGTTGGTCGCCGGATTGGTA ATCAAACATCTGGTGGGTATTGATAATTTT Gene lists Zhang et al., 2013
Marker18916 chr13 8,875,340 8,875,715 - GGATCGCTTGAAGCGGTTGATAAATTCTTC CCTCTTGGTGTCCTTTTGATTTTCATGATG Gene lists Zhang et al., 2013
Marker19640 chr13 11,710,496 11,710,839 + TGTCATATATATACACACATGATACCCATT AACTGAAATATAATGGGACCACAGATAAGT Gene lists Zhang et al., 2013
Marker20582 chr13 11,589,638 11,589,993 + ATTGCAGTAACAAAAGGATGATGAATATGG CCATAAACTCAATCTCAACAACAATAATAC Gene lists Zhang et al., 2013
Marker24597 chr13 11,590,472 11,590,816 - AAAATAATTGTTCAGAAGTTGGGTTAGACA TATGTTGCTTGTGAAAGAGAGCATGCCTAT Gene lists Zhang et al., 2013
Marker27614 chr13 11,867,870 11,868,195 - AATGACTCCTCACCTGATAGAAGTCTGCAC GTCGTAATTTATTTTTACATTCATCTACTC Gene lists Zhang et al., 2013
Marker31922 chr13 11,712,087 11,712,406 - GAAACATCCATTCCCTTAGTTGCGAAAAAC TCAGTTTCATCACCAATTTGGATTTTTTTT Gene lists Zhang et al., 2013
Marker31960 chr13 12,130,107 12,130,424 + ATAAGATATTTTTACAGGACAATAAACATA GGATTCTTGTTCTGCTCGATGACCTGTCCC Gene lists Zhang et al., 2013
Marker33170 chr13 11,629,799 11,630,181 - TAGATTGCCTCTATAAAGCCTCCATGGCTT TCTTATTCACCGCTTATCATTTTTGTATTA Gene lists Zhang et al., 2013
Marker37265 chr13 10,702,840 10,703,162 - AATCAACTAATGCATTGAGGTGGATGAGGG TAGAGACGGAATCCTTTTTATGATAAATTA Gene lists Zhang et al., 2013
Marker37512 chr13 11,488,048 11,488,410 - TAATGGCATACTTAGCTGAGTAAAAAAGTA ATAAGAGAAAGCAAAAATTAGCATTCATTC Gene lists Zhang et al., 2013
Marker4138 chr13 11,711,719 11,712,070 + GTGGAAGAGTTGTCTCCTGATAGTTTTCAA TGACTGTTTGACAAAAAGCTTGACTTGTCT Gene lists Zhang et al., 2013
Marker48588 chr13 11,715,975 11,716,334 + AGAAACAAATTGACCATAAAGAAAAGAAAA ATCCCAGACTCCTGAAAATAATAATAATAA Gene lists Zhang et al., 2013
Marker48881 chr13 11,616,317 11,616,656 + CAAGGAGAATTATTCTTGAAATTTCAAGGG TTTGAAGTATATATTGCGGAATTGTGCATA Gene lists Zhang et al., 2013
 
Copyright © 2017 Sesame Germplasm Resources Group, OCRI, CAAS, Admin: yujingyin@caas.cn