LOGO title
 Search Sinbase2.0

WWW SITE
 Resources>>Markers, Genes and QTLs>>Functional Markers:
 
Note: Please click location to get upstream and downstream flanking genes of corresponding sesame functional markers.
Marker id Location Strand Forward primer Reverse primer Trait Authors
HS002 chr9:4106203..4106366 + CCATTAAATTCTTGCTCCCC CTGGTCGTATGCAGCATCTT Dominant Male sterility Liu et al., 2015
HS003 chr6:2412571..2412743 + ACTTGGCCTACGAACAGCTT GGAAAAACACCTCGGAAGAA Dominant Male sterility Liu et al., 2015
Hs02 chr9:4106203..4106366 + CCATTAAATTCTTGCTCCCC CTGGTCGTATGCAGCATCTT Oil content and Protein content Li et al., 2014
HS045 chr7:16619050..16619263 + TCCCAGTCCCTTGAAAGAAG TGGGGAGAGAAAGGAAAGAA Dominant Male sterility Liu et al., 2015
Hs1036 chr12:16159427..16159142 - GCCTGCTTAGCTGCCTTTAG CAGACGGAGATGCAGATTGT Oil content and Protein content Li et al., 2014
HS117 chr7:9175174..9175401 + GCTCTTCCCTCAACACCATT CGCAGGTCTGGTGATAGAAC Dominant Male sterility Liu et al., 2015
HS135 chr7:13380825..13381018 + GTTGGAGTTGTGTTGGCATC ATAACCATCCCATTCCCTCG Dominant Male sterility Liu et al., 2015
Hs1638 chr4:9102467..9102712 + TAGGAAGAGGCATGTTCACG CCATCTCCACATCTTGCATC Oil content and Protein content Li et al., 2014
Hs1956 chr3:19997069..19997305 + CACAGTTACCATGGGCAAAG ACACCCATATTTCCAGGCAT Oil content and Protein content Li et al., 2014
Hs205 chr1:20124206..20124397 + GATGTGATGGTGGTGAGAGC GCTATGCGTTGAATGAAGAC Oil content and Protein content Li et al., 2014
HS216 chr7:6491329..6491608 + TGAGAGAGGTTAATTGGGGG TGGCTCCCATGTATTTACCA Dominant Male sterility Liu et al., 2015
HS291 chr7:10160745..10160965 + CATTCTCCTCAACCCATCCT GTGAGCTTCGCAGTCGTAAG Dominant Male sterility Liu et al., 2015
Hs345 chr3:20584741..20584980 + TCTCGCTTCTTTGAGAGCTA GCTACGCCAAACTCATTTCA Oil content and Protein content Li et al., 2014
Hs376 chr1:10371446..10371678 + AATGTGGCCAAGTTGAGGTT AAACAGCAAACTGGTGCTTG Oil content and Protein content Li et al., 2014
Hs377 chr1:10370604..10370873 + GGATATATGTCCATCGCCCT CAGCAAGACCAATGCCTCTA Oil content and Protein content Li et al., 2014
Hs393 chr8:22502615..22502870 + GACTGAGTTTGCAGCGAAAG GTGCTGCACACAGACACAAG Oil content and Protein content Li et al., 2014
Hs4061 chr3:21431704..21431857 + TTTGAGCATTCTGTCCTTGC   GACCTGAACTTCATCGGGTT   Oil content and Protein content Li et al., 2014
Hs4082 chr9:1891686..1891846 + AAATGCCAGCACACATTGTC   AAACAATCACCACTTGCTGC   Oil content and Protein content Li et al., 2014
Hs4209 chr3:25695430..25695667 + CACTCCCTCCCTAGTCCAAA   ATCCAAAGAGCTGCAGGAGT   Oil content and Protein content Li et al., 2014
Hs4381 chr9:4701570..4701754 + TGCCTGATGTGTTTGTGAGA   CTCAGGGTCGAATTGTGATG   Oil content and Protein content Li et al., 2014
Hs586 chr8:17775817..17776082 + CACTGGGTCTCCTCCACTCT ACTCCACCTTCAAATCCCAG Oil content and Protein content Li et al., 2014
Hs618 chr2:14331798..14331026 - CTCCCACTCACATGATGACC CAAGCATTTTCTCCACCAGA Oil content and Protein content Li et al., 2014
Hs635 chr9:13513948..13514174 + ATGAAGACATTCAACGCTGC CTCCACTACTCGCCATTTCA Oil content and Protein content Li et al., 2014
Hs672 chr6:13524825..13524592 - CACACACTCACCAACCCTCT CAGGGATGCAAGAACTGAAA Oil content and Protein content Li et al., 2014
Marker129539-Marker31462 chr4:17335020..17327486 + CTCAGTTTGCCCAAGATCAC
CTGCAATAAACAGACATATA
AGAAAGTACGCAGACAGACA
CAAACAAAAATGTATATATC
ACTATCTATATATGATTGAT
XXXXXXXXXXGACCACGTTG
TGTATTTCTCCCGAGCGATA
TGTTACATAGTGGTACATAT
TGGTAGTTCCGTTGGCGGAG
GAAGTACTAGCTCCCGGAGA
CGTACCGTAG
CTAACATATATTGACTGCAA
AATATATGGTAAGGATAAAG
TTTATTGTGCTTTTAATATT
TTTTGCTTAGTCTTTATGTG
ATTATTGCTTTTTATTAAAT
XXXXXXXXXXATTTATTATT
TGTAGATGTATATTAATTAA
TAGATAAATGAATCGGGTCA
AAAGTAGCACAATTAATTAC
TTTATAAATATAAAAGTGAG
ATCATCTATG
 Branching habit Mei et al., 2017
Marker58311-Marker36337 chr7:4919558..4919845 + ATTGTCTTCGTGGTGCTACT
TGTCACCATCCTTGAATTTT
TTTTTTCTCATGTGAGATTC
ATGTCATGCCTTGGTGTGTT
CCAAGTACAATCCAACATTC
XXXXXXXXXXATTGGATGAT
ACTTCAACTTGTGGTTTTAC
TTTTTGAATGGAAGTAAATC
CATTCAAAAGCAACACTTTC
TGCAATTTTGACTTCAATTC
TTATCCCATG
CTACATGGTTATCTAAATGG
TCCATAGGCATCTGTTGTGA
TGTTAAAGCAGTGCTTAACG
TAGTTGGTAAGCACAATAGA
CACATTTATCAAAGAAGAAT
XXXXXXXXXXCCTATTTCAA
CAATCTCCAACTTTACCTTA
AAGTCAATTACCCATATTTA
CAGACTAACTTGATCATGAG
CAATCTATGATACCAACTAG
GTCTTATGGG
Number of flower per axil Mei et al., 2017
SBI058 chr13:6041319..6041391 + CAGTGGAAATCGGACGG AAACTAACGAACCCTCTCTCTC Dominant Male sterility Liu et al., 2015
SBM298 chr7:14405910..14405773 - CCCCTTTTCACTTACGTACAGCAG CTCTTCCTCCACCATCTCCTCTTC Recessive Male sterility Liu et al., 2015
SE72-2 chr5:3812496..3812779 + GCAGCAGTTCCGTTCTTG AGTGCTGAATTTAGTCTGCATAG Protein content and Oleic acid content Wei et al., 2013
SSI429-1 chr10:12361381..12361263 - ATGCATTGCACGAATATCCCTC CATCATCGGGGAAGTTTTTATCAC Linoleic acid content and Oleic acid content Wei et al., 2013
Y2129 chr4:9205453..9205696 + GGGGCACAGAGTGGATGTAG  GGACCATGTAATCCCAGCAC Oil content and Protein content Li et al., 2014
 
Copyright © 2017 Sesame Germplasm Resources Group, OCRI, CAAS, Admin: yujingyin@caas.cn